Dr. Maha Daghestani DNA structure and function Dr. Maha Daghestani November 2007

Dr. Maha Daghestani

DNA Structure: Double Helix Watson and Crick 3-D structure of DNA DNA is a double helix (ll-stranded) Polymer of nucleotides (phosphate, sugar, base) DNA has 4 base types (adenine, thymine, guanine, cytosine)

Dr. Maha Daghestani DNA 1. Double Stranded Helix 2. Hydrogen Bonds between Nitrogenous Base Pairs 3. Adenine-Thymine and Guanine-Cytosine

Dr. Maha Daghestani DNA in a cell 1. Which organelles contain DNA ? Eukaryotic cells contain several organelles. The nucleus contains most of the DNA in a cell and this DNA is called the chromosomal DNA. It is separated from the rest of the cell (cytoplasm) by a double layer of membrane. The mitochondria, which have a role in the oxidative degradation of nutrient molecules, also contain DNA, called the mitochondrial DNA. Eucariotic cells that are capable of photosynthesis contain chloroplasts with chloroplast DNA.

Dr. Maha Daghestani

DNA Structure DNA composition PhosphateSugar Nucleic acids (bases) DNA Structure

Dr. Maha Daghestani 1-Basic chemical units A 5 carbon sugar - deoxyribose phosphate - link between sugars bases: purines = adenine and guanine pyrimidines = thymine and cytosine

Dr. Maha Daghestani. Nucleotides

Dr. Maha Daghestani This is the five-carbon sugar found in RNA.

Dr. Maha Daghestani This is the five-carbon sugar found in DNA.

Dr. Maha Daghestani How are they different?

phosphate sugar ADENINE (A) THYMINE (T) CYTOSINE (C) GUANINE (G) base 4 DNA Nucleotides

Dr. Maha Daghestani

Nitrogen bases

Dr. Maha Daghestani Nitrogen bases

Dr. Maha Daghestani ADENINE (A)

Dr. Maha Daghestani GUANINE (G)

Dr. Maha Daghestani THYMINE (T)

Dr. Maha Daghestani CYTOSINE (C)

Dr. Maha Daghestani

Gene: - segment of DNA that contains all the information needed for regulated synthesis of an RNA or protein product. Genome: - the entire DNA sequence content of an organism (nuclear DNA) Some Important Definitions

Dr. Maha Daghestani Genotype and Phenotype Genotype 1. Genetic Composition of an Organism 2. Represents the Potential Properties Phenotype 1. The Expression of the Genes 2. What You See

Dr. Maha Daghestani Gene Expression DNA codes for genes Genes are expressed as proteins Gene expression is regulated The genome of every cell in your body is identical Cell type is determined by the genes the cells express

Dr. Maha Daghestani What are genes Genes are working subunits of DNA. Genes, which are made up of DNA, act as instructions to make molecules called proteins In humans, genes vary in size from a few hundred DNA bases to more than 2 million bases. The Human Genome Project has estimated that humans have between 20,000 and 25,000 genes. Every person has two copies of each gene, one inherited from each parent.

Dr. Maha Daghestani Genes

Dr. Maha Daghestani

Replication The duplication of DNA which occurs during the S phase of Interphase. 1 Strand  2 Complementary Strands DNA Polymerase

Dr. Maha Daghestani DNA Replication Must be completed prior to cell division Helicase enzymes open the DNA Polymerase enzymes generate a new DNA strand on each old template

Dr. Maha Daghestani by adding one nucleotide after another to a growing daughter strand. the enzyme can build long strands of DNA

can only add nucleotides if they contain the sugar deoxyribose

Notice the deoxyribose sugar in each of these molecules.

and this hydrogen Cells remove this OH as a molecule of H2OH2O

Dr. Maha Daghestani - H 2 O

Dr. Maha Daghestani Two empty bonds remain after the molecule of water has been removed. - H 2 O

Dr. Maha Daghestani a new forms at this location, joining the two nucleotides. bond

a new forms at this location, joining the two nucleotides. bond

Dr. Maha Daghestani Growing daughter strands

Dr. Maha Daghestani

One More Time!

Dr. Maha Daghestani thymine adenine cytosine guanine phosphate deoxyribose sugar DNA nucleotide Deoxyribose sugar phosphate Nitrogenous base (guanine) RNA nucleotide ribose sugar phosphate Nitrogenous base (uracil) Sugar / phosphate “strand” Nitrogenous base “rung” Hydrogen bond (H-bonds) DNA Replication

Dr. Maha Daghestani Step 1: Hydrogen bonds between complimentary bases break DNA “unzips” DNA Replication

Dr. Maha Daghestani Step 2: DNA strands pull apart from each other DNA Replication

Dr. Maha Daghestani Step 3: DNA nucleotides in the cell match up with each side of the “unzipped” DNA each “unzipped’ strands forms a template for a new strand DNA Replication

Dr. Maha Daghestani Step 4: Each “old’ strand forms a template for a “new” strand two identical DNA molecules form “old” (original) strand “ new” strand, identical sequence to the original DNA Replication

Dr. Maha Daghestani Central Dogma

Dr. Maha Daghestani Central Dogma of Genetics DNA RNA Protein Replication Transcription Translation Reverse Transcription aa

Dr. Maha Daghestani Replication Transcription Translation

Dr. Maha Daghestani protein For a cell to make protein, the information from a gene is copied, base by base, from DNA into new strands of messenger RNA (mRNA). Then mRNA travels out of the nucleus into the cytoplasm, to cell organelles called ribosomes. There, mRNA directs the assembly of amino acids that fold into completed protein molecule.

Dr. Maha Daghestani DNA  RNA  Protein

Dr. Maha Daghestani Protein Synthesis proteinsThe production (synthesis) of proteins. 3 phases3 phases: 1.Transcription 2.RNA processing 3.Translation Remember:DNA  RNA  ProteinRemember:DNA  RNA  Protein

Dr. Maha Daghestani Question: RNA(ribonucleic acid) DNA (deoxyribonucleic acid)How does RNA (ribonucleic acid) differ from DNA (deoxyribonucleic acid)?

Dr. Maha Daghestani RNADNA RNA differs from DNA RNAsugar ribose 1. RNA has a sugar ribose DNAsugar deoxyribose DNA has a sugar deoxyribose RNAuracil (U) 2.RNA contains uracil (U) DNAthymine (T) DNA has thymine (T) RNAsingle- stranded 3.RNA molecule is single- stranded DNAdouble-stranded DNA is double-stranded

Dr. Maha Daghestani 1. Transcription nucleus DNARNAThe transfer of information in the nucleus from a DNA molecule to an RNA molecule. 1 DNAtemplateOnly 1 DNA strand serves as the template DNAStarts at promoter DNA (TATA box) DNAEnds at terminator DNA (stop) pre-RNAWhen complete, pre-RNA molecule is released.

Dr. Maha Daghestani Question: What is the enzyme responsible for the production of the RNA molecule?What is the enzyme responsible for the production of the RNA molecule?

Dr. Maha Daghestani Answer: RNA Polymerase DNASeparates the DNA molecule by breaking the H-bonds between the bases. DNA strandsRNAThen moves along one of the DNA strands and links RNA nucleotides together.

Dr. Maha Daghestani 1. Transcription DNApre-mRNA RNA Polymerase

Dr. Maha Daghestani Question: RNA DNAWhat would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’

Dr. Maha Daghestani Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’

Dr. Maha Daghestani 2. RNA Processing pre-RNAMaturation of pre-RNA molecules. nucleus.Also occurs in the nucleus. Intronssplicesome-enzyme exonsIntrons spliced out by splicesome-enzyme and exons come together. mature RNA molecule nucleuscytoplasm.End product is a mature RNA molecule that leaves the nucleus to the cytoplasm.

Dr. Maha Daghestani 2. RNA Processing pre-RNA molecule intron exon Mature RNA molecule exon intron splicesome

Dr. Maha Daghestani During transcription, one DNA strand, the template strand, provides a template for ordering the sequence of nucleotides in an RNA transcript

Dr. Maha Daghestani Types of RNA Three types ofRNAThree types of RNA: A.messenger RNA (mRNA) B.transfer RNA (tRNA) C.ribosome RNA (rRNA) Remember: all produced in the nucleus!Remember: all produced in the nucleus!

Dr. Maha Daghestani A. Messenger RNA (mRNA) proteinCarries the information for a specific protein. nucleotidesMade up of 500 to 1000 nucleotides long. codonsMade up of codons (sequence of three bases: AUG - methionine). codonamino acidEach codon, is specific for an amino acid.

Dr. Maha Daghestani A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

Dr. Maha Daghestani B. Transfer RNA (tRNA) Made up of 75 to 80 nucleotides long. amino acid amino acid activating enzymePicks up the appropriate amino acid floating in the cytoplasm (amino acid activating enzyme) amino acids mRNATransports amino acids to the mRNA. anticodons mRNAcodonsHave anticodons that are complementary to mRNA codons. codons mRNARecognizes the appropriate codons on the mRNA and bonds to them with H-bonds.

Dr. Maha Daghestani A tRNA molecule consists of a strand of about 80 nucleotides that folds back on itself to form a three- dimensional structure. –It includes a loop containing the anticodon and an attachment site at the 3’ end for an amino acid. Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Fig

Dr. Maha Daghestani C. Ribosomal RNA (rRNA) rRNAMade up of rRNA is 100 to 3000 nucleotides long. ribosome.Important structural component of a ribosome. proteins ribosomes.Associates with proteins to form ribosomes.

Dr. Maha Daghestani Ribosomes Large and small subunits.Large and small subunits. rRNA (40%) proteins (60%).Composed of rRNA (40%) and proteins (60%). mRNAtRNA.Both units come together and help bind the mRNA and tRNA. Two sites fortRNATwo sites for tRNA P site tRNA will attach a.P site (first and last tRNA will attach) A site b.A site

Dr. Maha Daghestani

Each ribosome has a binding site for mRNA and three binding sites for tRNA molecules. –The P site holds the tRNA carrying the growing polypeptide chain. –The A site carries the tRNA with the next amino acid. –Discharged tRNAs leave the ribosome at the E site. Fig b &c

Dr. Maha Daghestani Translation can be divided into three stages: initiation elongation termination All three phase require protein “factors” that aid in the translation process. Both initiation and chain elongation require energy provided by the hydrolysis of GTP. Translation

Dr. Maha Daghestani Initiation brings together mRNA, a tRNA with the first amino acid, and the two ribosomal subunits. –First, a small ribosomal subunit binds with mRNA and a special initiator tRNA, which carries methionine and attaches to the start codon. –Initiation factors bring in the large subunit such that the initiator tRNA occupies the P site. Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Fig

Dr. Maha Daghestani Elongation consists of a series of three step cycles as each amino acid is added to the proceeding one. During codon recognition, an elongation factor assists hydrogen bonding between the mRNA codon under the A site with the corresonding anticodon of tRNA carrying the appropriate amino acid. –This step requires the hydrolysis of two GTP. Elongation

Dr. Maha Daghestani The three steps of elongation continue codon by codon to add amino acids until the polypeptide chain is completed. Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Fig

Dr. Maha Daghestani Termination occurs when one of the three stop codons reaches the A site. A release factor binds to the stop codon and hydrolyzes the bond between the polypeptide and its tRNA in the P site. This frees the polypeptide and the translation complex disassembles. Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Fig

Dr. Maha Daghestani 3. Translation Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

Dr. Maha Daghestani 3. Translation proteinscytoplasmSynthesis of proteins in the cytoplasm Involves the following:Involves the following: mRNA (codons) 1.mRNA (codons) tRNA (anticodons) 2.tRNA (anticodons) rRNA 3.rRNA ribosomes 4.ribosomes amino acids 5.amino acids

Dr. Maha Daghestani 3. Translation Three parts: initiation 1.initiation: start codon (AUG) elongation 2.elongation: termination 3.termination: stop codon (UAG) PROTEIN!!!!Let’s make a PROTEIN!!!!.

Dr. Maha Daghestani 3. Translation P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

Dr. Maha Daghestani Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

Dr. Maha Daghestani mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

Dr. Maha Daghestani mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

Dr. Maha Daghestani mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

Dr. Maha Daghestani mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

Dr. Maha Daghestani mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

Dr. Maha Daghestani mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

Dr. Maha Daghestani mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

Dr. Maha Daghestani End Product primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein. amino acid peptide bondsA sequence of amino acid bonded together by peptide bonds. aa1 aa2 aa3 aa4 aa5 aa200 aa199

Dr. Maha Daghestani Polyribosome mRNA proteins (polypeptides).Groups of ribosomes reading same mRNA simultaneously producing many proteins (polypeptides). incoming large subunit incoming small subunit polypeptide mRNA

Dr. Maha Daghestani Question: The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid.The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid. What would be the DNA base code for this amino acid?What would be the DNA base code for this amino acid?

Dr. Maha Daghestani Answer: tRNA - UAC (anticodon)tRNA - UAC (anticodon) mRNA- AUG (codon)mRNA- AUG (codon) DNA - TACDNA - TAC

Dr. Maha Daghestani

Thank you