Effects of per on longevity and fecundity in Drosophila James Lester Dr. Jadwiga Giebultowicz.

Slides:

Advertisements

Similar presentations

Inactive and couch potato mutants of Drosophila: Locomotor activity vs metabolism Inactive and couch potato mutants of Drosophila: Locomotor activity vs.

Advertisements

Age Management Relative Impact of Curing Diseases and Slowing Aging.

1 Adaptation in Beef Cattle T. G. Jenkins Meat Animal Research Center Clay Center NE.

Nick Meermeier, Natraj Krishnan, Jadwiga M Giebultowicz (

Role of Clock Gene period in Starvation Resistance

Circadian Susceptibility to Pyrethroids in Female Drosophila melanogaster By David Chin Mentor: Dr. Jadwiga Giebultowicz.

Figure 5.2 Nervous system of a praying mantis

Biological clocks Clock periods –Circannual –Circalunidian –Circadian Clock mechanisms –Entrainment –Neural location –Genetic basis.

Does the Circadian Clock Modulate an Organism’s Response to Toxins? Katherine Sherman Mentor: Dr. Jaga Giebultowicz Co-Mentor: Dr. Louisa Hooven.

Dr. Jaga Giebultowicz Lab

Getting Healthy Biggest Bang for the Buck! Dr Alan Cranton DC, ND.

CIRCADIAN RHYTHMS

 Hypothalamus- The Hypothalamus is a part of the brain that secretes hormones in the pituitary gland. It controls water balance, sleep, temperature,

Hybrid Animals.  A Hybrid is a mating of two different species  Mutants are natural variations that occur due to spontaneous genetic changes or the.

Insulin-like signaling pathway: flies and mammals

Dietary Causes of the Metabolic Syndrome Roadmap to Metabolic Health 4 Life™

Midterm Distribution Mean = N = 68 Grade (%) Frequency (#)

Cellular and Molecular response to Nanoparticle Exposure By: Jewels Morgan.

Dr. Karen Vieira & Shawn Stevenson

Adolescence – Biosocial Development

The Evolution of Life Span Why do we live as long as we do?

Changing habitats, changing populations? Life-history evolution of coexisting Drosophila species in a heterogeneous environment. Institute for Evolutionary.

Taattcgcggccgcttctagagattgtgagcggataacaattgacattgtgagcggataacaagatactgagcactactagagaaagaggagaaatactagatgactataatgataaaaaaat cggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactc.

 A balanced diet combined with regular exercise aid in the overall general health of the body.  Humans require energy to function. The total energy used.

 Define genotype and phenotype and know the differences with 100% accuracy.  Define purebred breeding and crossbreeding and know the differences with.

Trace Winegar LEPTIN. FACTS ABOUT LEPTIN Leptin is a protein produced in fat cells, circulates in the bloodstream and ends up in the brain Produced all.

8.3 & 8.4 AP Biology Lecture Genes are carried on Chromosomes.

Defined*: the interactions between biological, psychological, and social variables. Health Psychology* : the study of determining the importance of psychological.

Today: Diets and Calorie Restriction. In class activity: Of the diets that you researched: Which would be best for losing weight? Which would be best.

Melissa Spear Phillips Lab Mentor: Rose Reynolds SPUR 2011 Evolution of Genetic Networks Controlling Cellular Stress Response and Longevity.

The Evolution of Life Span Why do we live as long as we do?

Breed A Breed B Crossbred AB Breed C Crossbred CxAB Terminal Crossbreeding System.

P u t t i n g y o u r h e a l t h f i r s t “You are the architect of your own destiny, the creator of your own reality. And as such, your life and your.

“Facilitated adaptive evolution of Caenorhabditis elegans by use of the chemical paraquat” Jeremy Northway A review of healthy aging research:

6.5 Solving Exponential Equations SOLVE EXPONENTIAL EQUATIONS WITH THE SAME BASE. SOLVE EXPONENTIAL EQUATIONS WITH UNLIKE BASES.

A set of equations involving the same variables A solution is a collection of values that makes each equation true. Solving a system = finding all solutions.

Chapter 12 Section 1.

Unit 6 Avian Behavior.

Volume 7, Issue 11, Pages R670-R672 (November 1997)

Diet Analysis % frequency of occurrence (%O), i.e., the number of stomachs in which a food item occurs expressed as a percentage of all stomachs containing.

Steroid Signaling Establishes a Female Metabolic State and Regulates SREBP to Control Oocyte Lipid Accumulation Matthew H. Sieber, Allan C. Spradling

التعامل مع ضغوطات العمل إعداد وتقديم إقبال المطيري

الإيقاع الحيوي biorhythm

Volume 14, Issue 8, Pages (April 2004)

Daily and Seasonal Timing

Selective Plant Breeding

Life Is Short, if Sweet Cell Metabolism

The Drosophila ovary and germarium, bab1-GAL4 expression in larval ovaries, and the screening strategy. The Drosophila ovary and germarium, bab1-GAL4 expression.

Incomplete Dominance.

Circadian Control of Eclosion

Matthew H. Sieber, Carl S. Thummel Cell Metabolism

STORE MANAGER RESPONSIBILITIES.

Volume 23, Issue 1, Pages (January 2016)

Volume 13, Issue 6, Pages (June 2011)

The Drosophila Clock Neuron Network Features Diverse Coupling Modes and Requires Network-wide Coherence for Robust Circadian Rhythms Zepeng Yao, Amelia.

Time Flies for Drosophila

Volume 66, Issue 3, Pages (May 2010)

Abhishek Chatterjee, Shintaro Tanoue, Jerry H. Houl, Paul E. Hardin

I Died Last Night Believe (Jn. 8:24) Repent (Lk. 13:3)

Drosophila CRYPTOCHROME Is a Circadian Transcriptional Repressor

equivalent expression

Volume 26, Issue 7, Pages (April 2016)

Kanyan Xu, Xiangzhong Zheng, Amita Sehgal Cell Metabolism

By James Life Website: jameslifebooks.weebly.com

Volume 22, Issue 19, Pages (October 2012)

Fig. 1. Phenotypes of RasV12 transformed Drosophila lines

6.6 Hormones and homeostasis

Matthew H. Sieber, Carl S. Thummel Cell Metabolism

Volume 17, Issue 5, Pages (October 2016)

Volume 14, Issue 8, Pages (April 2004)

Presentation transcript:

Effects of per on longevity and fecundity in Drosophila James Lester Dr. Jadwiga Giebultowicz

Dr. Giebultowicz’s research Circadian Rhythms Clock Genes Tim Per Effects of expression

Increased longevity

Increased fecundity

Copulating Drosophila

My research Verify UAS Gal4 x UAS per results Eliminate cross breeding as variable Determine how per increases longevity and fecundity Cross-breeding – UAS Gal4 x UAS per (over expressed) – UAS per x White – UAS Gal4 x White – White x White – Wper01 x Wper01 (no expression)

Possible Longevity Factors Diet: How much food is eaten? How much is stored? Ovaries: Do the ovaries develop at different rates? Stress resistance: -Heat -Oxidative stress -Metabolic stress

Preliminary Metabolic Stress Results

Results Aging of cross-bred and over expressed is ongoing… Metabolic and oxidative tests are about to occur… Aging of virgins The fun has just begun!!!