Copyright Pearson Prentice Hall

Slides:



Advertisements
Similar presentations
12-3 RNA and Protein Synthesis
Advertisements

RNA and Protein Synthesis
RNA and Protein Synthesis
End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology Protein Synthesis: I will understand the general pathway of transcription and translation.
Understanding Protein Synthesis
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology.
VII RNA and Protein Synthesis
End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis RNA and Protein Synthesis.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis 12–3 RNA and Protein Synthesis.
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Copyright Pearson Prentice Hall
End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis 12–3 RNA and Protein Synthesis.
What is central dogma? From DNA to Protein
RNA & Protein Synthesis Ribose RNA. DNARNA StructureDouble Stranded Single Stranded Bases- PurinesAdenine (A) Guanine (G) Bases - Pyrimidines Cytosine.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Question of the DAY Jan 14 During DNA Replication, a template strand is also known as a During DNA Replication, a template strand is also known as a A.
RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.
Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Genes are DNA instructions that control the.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
End Show 12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 106. What are genes? They are coded.
RNA and Transcription. Genes Genes are coded DNA instructions that control the production of proteins within the cell To decode the genetic message, you.
Chapter 13 From DNA to Proteins
Notes: Transcription DNA vs. RNA
RNA and Protein Synthesis
RNA & Protein synthesis
Copyright Pearson Prentice Hall
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
BIOLOGY NOTES GENETICS PART 7 PAGES
12-3 RNA and Protein Synthesis
From dna to rna.
BIOLOGY NOTES GENETICS PART 7 PAGES
Bellwork: Tues. Nov. 28, 2017 What is each number?
RNA Ribonucleic Acid.
Bellwork: Thurs. Nov. 30, 2017.
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
What is RNA? Do Now: What is RNA made of?
12-3 RNA and Protein Synthesis
BIOLOGY NOTES GENETICS PART 7 PAGES
RNA and Protein Synthesis
RNA and Transcription DNA RNA PROTEIN.
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Copyright Pearson Prentice Hall
Lesson Overview 13.1 RNA
RNA & Protein synthesis
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Comparing RNA and DNA Each nucleotide in both DNA and RNA is made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base. There are three important.
I will understand the general pathway of transcription and translation
BIOLOGY NOTES GENETICS PART 7 PAGES
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
RNA and Protein Synthesis
Genes and Protein Synthesis Review
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
4a. Know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA.
Presentation transcript:

Copyright Pearson Prentice Hall Biology Biology Copyright Pearson Prentice Hall

12-3 RNA and Protein Synthesis Copyright Pearson Prentice Hall

12–3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by copying part of the nucleotide sequence from DNA into RNA. RNA contains coded information for making proteins. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Structure of RNA The Structure of RNA There are three main differences between RNA and DNA: The sugar in RNA is ribose instead of deoxyribose. RNA is generally single-stranded. RNA contains uracil in place of thymine. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA Types of RNA There are three main types of RNA: messenger RNA ribosomal RNA transfer RNA Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Messenger RNA (mRNA) carries copies of instructions for assembling amino acids into proteins. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA Ribosome Ribosomal RNA The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Ribosomal RNA is combined with proteins to form ribosomes. Ribosomes are made up of proteins and ribosomal RNA (rRNA). Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA Amino acid The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Transfer RNA During protein construction, transfer RNA (tRNA) transfers each amino acid to the ribosome. Copyright Pearson Prentice Hall

Protein Synthesis DNA molecule DNA strand (template) 3¢ 5¢ TRANSCRIPTION mRNA 5¢ 3¢ Codon TRANSLATION Protein Amino acid

Copyright Pearson Prentice Hall Transcription Transcription DNA is copied in the form of RNA This first process is called transcription. The process begins at a section of DNA called a promoter. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Transcription RNA RNA polymerase DNA During transcription, RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall RNA Editing RNA Editing Some DNA within a gene is not needed to produce a protein. These areas are called introns. The DNA sequences that code for proteins are called exons. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall RNA Editing The introns are cut out of RNA molecules. The exons are the spliced together to form mRNA. Exon Intron DNA Pre-mRNA mRNA Many RNA molecules have sections, called introns, edited out of them before they become functional. The remaining pieces, called exons, are spliced together. Then, a cap and tail are added to form the final RNA molecule. Cap Tail Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code The Genetic Code The genetic code is the “language” of mRNA instructions. The code is written using four “letters” (the bases: A, U, C, and G). Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code A codon consists of three consecutive nucleotides on mRNA that specify a particular amino acid. A codon is a group of three nucleotides on messenger RNA that specify a particular amino acid. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code The genetic code shows the amino acid to which each of the 64 possible codons corresponds. To decode a codon, start at the middle of the circle and move outward. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Translation Translation is the decoding of an mRNA message into a polypeptide chain (protein). Translation takes place on ribosomes. During translation, the cell uses information from messenger RNA to produce proteins. Nucleus mRNA Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation The ribosome binds new tRNA molecules and amino acids as it moves along the mRNA. Lysine Phenylalanine tRNA Methionine Ribosome During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Start codon Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Protein Synthesis Lysine tRNA During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Translation direction Ribosome Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation The process continues until the ribosome reaches a stop codon. Polypeptide Ribosome tRNA During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Copyright Pearson Prentice Hall

Amino acids within a polypeptide Genes and Proteins Codon Codon Codon DNA mRNA Protein Single strand of DNA Codon Codon Codon mRNA This diagram illustrates how information for specifying the traits of an organism is carried in DNA. The sequence of bases in DNA is used as a template for mRNA. The codons of mRNA specify the sequence of amino acids in a protein, and proteins play a key role in producing an organism’s traits. Alanine Arginine Leucine Amino acids within a polypeptide Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall 12–3 Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall 12–3 The role of a master plan in a building is similar to the role of which molecule? messenger RNA DNA transfer RNA ribosomal RNA Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall 12–3 A base that is present in RNA but NOT in DNA is thymine. uracil. cytosine. adenine. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall 12–3 The nucleic acid responsible for bringing individual amino acids to the ribosome is transfer RNA. DNA. messenger RNA. ribosomal RNA. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall 12–3 A region of a DNA molecule that indicates to an enzyme where to bind to make RNA is the intron. exon. promoter. codon. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall 12–3 A codon typically carries sufficient information to specify a(an) single base pair in RNA. single amino acid. entire protein. single base pair in DNA. Copyright Pearson Prentice Hall

END OF SECTION