Welcome to the world of two Arabidopsis genes: At4g14770 and At3g22760 At4g14770 and At3g22760 Presented by: Matt Emmer HC70AL Spring 2006

At4g14770 and At3g22760: Tesmin/TSO1-like CXC Domain Proteins involved in cellular expansion and cytokinesis, as well as in the development of ovules and microspores Contains two cysteine-rich regions similar to CXC domains involved in chromosome segregation Tesmin a member of the CXC family, and a testis-specific protein Necessary enzyme in gibberellin biosynthetic pathway, involved in mobilization of food in seeds and stem elongation. Tesmin/cxc/tso-1 Root nodules, cpp,

Structure of At4g14770 (1st Line) Gene Size 3452 bp # of Exons 8 # of Introns 7 Protein Encoded Tesmin/TSO1-like CXC Domain # of Amino Acids 659 T-DNA Location First Intron

Structure of At3g22760 (2nd Line) ? Gene Size 3076 bp # of Exons 10 # of Introns 9 Protein Encoded Tesmin/TSO1-like CXC Domain # of Amino Acids 610 T-DNA Location 5’ UTR

Where is At4g14770 Expressed?

Where is At3g22760 Expressed?

Were there Mutants in the 1st Line? WT Mut 9 Homozygous Mutants Identified in First Line 1 Heterozygous Mutant Expected Size Wild Type 802 bp T-DNA 644 bp

Were there Mutants in the 2nd Line? 4.5 ng/μL Plant 13 1.5 ng/μL Plant 12 4 ng/μL Plant 10 15 ng/μL Plant 4 5 ng/μL Plant 3 Concentration Plant 0.5 ng/μL Wild Type 2 ng/μL Plant 18 Plant 16 Plant 15 What were the DNA Concentrations? Were there Mutants in the 2nd Line? 1,624 bp Wild Type 1,095 bp T-DNA Expected Size No Mutants

Genotyping with separate primers

Seeds and Silique

Embryos

Mutant vs. Wild Type Mutant Wild Type Any Difference? NO

Single EcoRI Site in Upstream Region What’s Upstream of At4g14770? 1918 + 1319 = 3237 1918 bp 3237 bp 1319 bp I-proof Pcr Ecori Digest Single EcoRI Site in Upstream Region

Upstream Bioinformatics Primers Eco RI Site

How accurate was the SP6 and T7 Sequencing Data? Only a single mismatch in the SP6 sequencing data Actual Sequence: AAAGTAACGGACATCAGTTTTTTTTTTCTTTTCCCTTTTTTCTCTTTTTTG

What’s Upstream of At3g22760? 2911 bp I-proof Pcr Ecori Digest

Did the T-DNA insert actually knock out At4g14770?

Did the T-DNA insert actually knock out At4g14770? Two Possibilities: Intron was spliced out T-DNA was not spliced out, resulting in a longer mRNA strand Follow up experiment: Intron could be spliced out, but not necessarily the case. Intron spliced out: Possible T-DNA sequence causes transcriptional termination: No T-DNA not spliced out—get long mRNA strand (mutant protein): possible T-DNA not spliced out—mRNA targeted for degradation: No

Conclusions 1st Line mutants were attained No mutant phenotype observed Evidence to suggest that gene knockout was not successful Limited information obtained for 2nd line No mutant plants attained SALK indicates a T-DNA insert is in 5’ UTR, so gene may not have been knocked out Future Experiments Double/Triple Knock Outs to overcome duplication: At4g14770, At3g22760, At3g22780

Acknowledgements The TA’s Mike Gaviño Ria Yagnik Jonathan Russell Big Shots To Be Tomokazu Kawashima Brandon Le Jessica Luke The Big Shots Dr. Bob Goldberg Dr. Anhthu Bui Dr. Xingjun Wang HC70AL Jordan, Thi, Jennifer, Brian, Jordan, Jason, Daisy, Bekah, and Heather Cool intro slide What Genes am I working with? What is the structure of my genes? What are the properties? Size Number of amino acids Exons and introns Genotyping Results Where are my genes active: gene chip/RT-PCR RT-PCR: expected size, restriction sites, in over-exposure gene is active in leaf refuting gene chip data Phenotypic Results T-DNA was inserted in intron. Was it actually knocked out? Promoter Expected size, explanation of 3 bands Matches, ignored, mismatch Conclusions Not important to development Compensated for by another gene (double knockout?) Not detectable by these experimental procedures 14770 Duplication:At3g22760, At3g22780