Transcription and Translation
Watch the YouTube Video to answer the questions From DNA to Protein 3D Watch the YouTube Video to answer the questions https://www.youtube.com/watch?v=gG7uCskUOrA
3 Types of RNA Messenger RNA (mRNA): Take “messages” from DNA to ribosomes for protein production. Ribosomal RNA (rRNA): Combine with proteins to make up ribosomes. Transfer RNA (tRNA): Used to deliver amino acids to the ribosome according to mRNA sequence. RNA and DNA Differences: RNA has Uracil while DNA has Thymine. RNA has Ribose sugar while DNA has Deoxyribose sugar.
Transcription Transcription- DNA codes for a messenger RNA strand that leaves the nucleus to move to a ribosome in the cytoplasm. Uses RNA polymerase to bind complimentary RNA nucleotides to a template DNA strand. Transcription starts at the promoter region (which has specific base sequences) of a DNA strand. Non-Template strand= the other side of the DNA that is not being translated. Example of Transcription: Template DNA: A T T A C C T T G G G A T G C G Complimentary messenger RNA: U A A U G G A A C C C U A C G C Non-Template Strand of DNA: T A A T G G A A C C C T A C G C
mRNA Editing Eukaryotic cells edit their messenger RNA before it reaches a ribosome. They cut out sections called introns which do not code for proteins. Exons are then joined together which code for protein expression. A guanine cap and poly-A (A for adenine) tail are also added.
Gene Regulation Some genes are not constantly expressed so transcription is blocked. This means that certain proteins are only needed some of the time. Repressor Proteins: Bind to genes that are not to be expressed. Inducer Molecule: “Unblocks” genes for expression. Lac operon is an example. There is a repressor on the gene for lactase normally until lactose shows up and acts as an inducer to unblock the gene and so cause lactase production.
Translation mRNA is now at the ribosome and protein synthesis starts with AUG which is the start codon. All codons are 3 bases long, which means all anticodons are 3 bases long. When a stop codon is reached, protein synthesis stops. Use the genetic code to decipher which codon corresponds to which amino acid.
The Genetic Code Match Codon on mRNA to chart and get the amino acid coded for. Start in center on wheel and radiate out. Start in side on chart (1st letter) then top (2nd letter) then find all 3 in box.
Translation Continued Decode the mRNA strand to create a polypeptide. Remember to start at start codon. mRNA Strand: CGGAUGCAGAAUCCCUGAACGC tRNA Anticodon: GCCUACGUCUUAGGGACUUGCG Polpeptide (Amino Acid Chain): Meth-Gln-Asn-Pro Remember RCL: Replication TransCription TransLation