GENETICS UNIT 3

The base of genetics are the molecules of DNA and RNA Both DNA and RNA are very long molecules but their structure is very simple because they are formed by the repetition of the same unit: a nucleotide. Both DNA and RNA are very long molecules but their structure is very simple because they are formed by the repetition of the same unit: a nucleotide. DNA and RNA are polymers and nucleotides are their monomers. DNA and RNA are polymers and nucleotides are their monomers.

Nucleotides

Components of DNA (desoxyribonucleic acid) Sugar: 2-deoxyribose (or just deoxyribose) Phosphate group Nitrogenous base: thymine, adenine, cytosine and guanine

Components of DNA

A sugar, a phosphate group and a nitrogenous base join to form a nucleotide

Nucleotides are linked by a phosphodiester bond

Long chains of nucleotides are formed, all joined by phosphodiester bonds

The structure of DNA is a double helix of two large chains of nucleotides. The two chains are antiparallel.

In the double helix adenine is always joined to thymine and guanine is always joined to cytosine. ALWAYS. Bases are joined by a type of bond that is called “hydrogen bond”. Between thymine and adenine there are two hydrogen bonds and between guanine and cytosine there are three hydrogen bonds.

The order of the bases in DNA gives genetic information In DNA the sugar and the phosphate group are just the “skeleton”: thanks to them the chains of DNA are formed. But it is the sequence of nitrogenous bases that gives the genetic information. We usually refer to one part of DNA by the order of the sequence of the bases, for example: 3´ ATTCAGCATCG 5´

Exercise Write the other strand of DNA in a double helix for the following sequences: Write the other strand of DNA in a double helix for the following sequences: a) 3´ATTCGACCGTACGAAAATACGGG5´ b) 5´CGATCCGCAATTCGACCGTTTAG3´

Components of RNA (ribonucleic acid) Sugar: ribose Phosphate group Nitrogenouse base: uracil (NOT thymine), adenine, cytosine and guanine

Components of RNA

A sugar, a phosphate group and a nitrogenous base also join to form a nucleotide. A sugar, a phosphate group and a nitrogenous base also join to form a nucleotide. Nucleotides are linked by phosphodiester bonds to form long chains of RNA. Nucleotides are linked by phosphodiester bonds to form long chains of RNA.

Structure of RNA

In RNA we don´t have a double helix but we can have loops in some parts

In prokaryotic cells (bacterias) the DNA is in the cytoplasm (no separation from other components of the cell)

In eukaryotic cells (humans, animals, plants…) the DNA is in the nucleus, separated from other parts of the cell. We are going to focus on eukaryotic cells.

In humans, plants and animals DNA is joined to proteins forming chromosomes

Chromosomes Each species have a specific number of chromosomes. For example, humans have 46 chromomes. Each species have a specific number of chromosomes. For example, humans have 46 chromomes. Chromosomes can only be seen when the cell is dividing, in a process called mitosis. In the mitosis the chromosomes are condensed and that´s why we can see them. Chromosomes can only be seen when the cell is dividing, in a process called mitosis. In the mitosis the chromosomes are condensed and that´s why we can see them.

Celular cycle

Phases in the life of a cell Interphase: the cell is not dividing. During the interphase the DNA duplicates so that when the cell divides in two, each new cell has the same DNA as the original cell. Interphase: the cell is not dividing. During the interphase the DNA duplicates so that when the cell divides in two, each new cell has the same DNA as the original cell. Mitosis: the cell divides in two daughter cells. Mitosis: the cell divides in two daughter cells.

Chromosomes at the begining of the mitosis: as the DNA has been duplicated they are formed by two chromatids.

Sexual reproduction and meiosis Meiosis is used to form gametes (sperm and egg cells). Meiosis is used to form gametes (sperm and egg cells). In species with sexual reproduction the offspring is produced by the combination of the DNA of two individuals, the father and the mother. In species with sexual reproduction the offspring is produced by the combination of the DNA of two individuals, the father and the mother.

Sexual reproduction and meiosis When a spermatozoon and an egg cell join they form the zygote, which is the initial cell of a new individual. This initial cell will have several mitosis to form the complete new individual. When a spermatozoon and an egg cell join they form the zygote, which is the initial cell of a new individual. This initial cell will have several mitosis to form the complete new individual. As the zygote is the combination of a spermatozoon and an egg cell, both the spermatozoon and the egg cell have half the amount of the genetic information of the parents, so that the offspring don´t have twice the amount of DNA of their parents. As the zygote is the combination of a spermatozoon and an egg cell, both the spermatozoon and the egg cell have half the amount of the genetic information of the parents, so that the offspring don´t have twice the amount of DNA of their parents.

Sexual reproduction and meiosis During a process called meiosis the genetic information of a cell is reduced to half the amount of it so that a gamete is formed. During a process called meiosis the genetic information of a cell is reduced to half the amount of it so that a gamete is formed. Masculine gametes are called spermatozooa (plural for spermatozoon) and female gametes are called egg cells. Masculine gametes are called spermatozooa (plural for spermatozoon) and female gametes are called egg cells.

Sexual reproduction and meiosis A lot of species, humans for example, are diploid (2n), that means that they have pairs of chromosomes, each pair called “homologous chromosomes”, and these are chromosomes that contain the same genes. A lot of species, humans for example, are diploid (2n), that means that they have pairs of chromosomes, each pair called “homologous chromosomes”, and these are chromosomes that contain the same genes. Humans have 46 chromosomes, or, better said, 23 pairs of chromosomes (2n, n=23). Humans have 46 chromosomes, or, better said, 23 pairs of chromosomes (2n, n=23).

Female human karyotype

Sexual reproduction and meiosis During the meiosis the pairs of chromosomes (homologous chromosomes) are separated so we obtain cells that have half the genetic information of an individual. Hence, a gamete is formed, which is haploid (n). During the meiosis the pairs of chromosomes (homologous chromosomes) are separated so we obtain cells that have half the genetic information of an individual. Hence, a gamete is formed, which is haploid (n). In the case of humans, both spermatozooa and egg cells have 23 chromosomes. In the case of humans, both spermatozooa and egg cells have 23 chromosomes.

Sexual reproduction and meiosis (in the example, n=2)

When a spermatozoon (n) fertilizes an egg (n), a zygote is obtained (2n)

Mendel laws Once upon a time (1860's), in an Austrian monastery, there lived a monk named Gregor Mendel. Monks had a lot of time on their hands and Mendel spent his time crossing pea plants. As he did this over & over & over & over & over again, he noticed some patterns to the inheritance of traits from one set of pea plants to the next. By carefully analyzing his pea plant numbers (he was really good at mathematics), he discovered three laws of inheritance. Mendel's Laws are as follows: Once upon a time (1860's), in an Austrian monastery, there lived a monk named Gregor Mendel. Monks had a lot of time on their hands and Mendel spent his time crossing pea plants. As he did this over & over & over & over & over again, he noticed some patterns to the inheritance of traits from one set of pea plants to the next. By carefully analyzing his pea plant numbers (he was really good at mathematics), he discovered three laws of inheritance. Mendel's Laws are as follows: 1. the Law of Dominance 2. the Law of Segregation 3. the Law of Independent Assortment 1. the Law of Dominance 2. the Law of Segregation 3. the Law of Independent Assortment

Mendel´s laws In Mendel´s work the words "chromosomes" or "genes" are nowhere to be found. That is because the role of these things in relation to inheritance & heredity had not been discovered yet. What makes Mendel's contributions so impressive is that he described the basic patterns of inheritance before the mechanism for inheritance (namely genes) was even discovered. In Mendel´s work the words "chromosomes" or "genes" are nowhere to be found. That is because the role of these things in relation to inheritance & heredity had not been discovered yet. What makes Mendel's contributions so impressive is that he described the basic patterns of inheritance before the mechanism for inheritance (namely genes) was even discovered.

Mendel´s laws There are a few important vocabulary terms we should iron-out before diving into Mendel's Laws. There are a few important vocabulary terms we should iron-out before diving into Mendel's Laws. GENOTYPE = the genes present in the DNA of an organism. We will use a pair of letters (ex: AA or Aa or aa, etc.) to represent genotypes for one particular trait. There are always two letters in the genotype because (as a result of sexual reproduction) one code for the trait comes from mama organism & the other comes from papa organism, so every offspring gets two codes (two letters). GENOTYPE = the genes present in the DNA of an organism. We will use a pair of letters (ex: AA or Aa or aa, etc.) to represent genotypes for one particular trait. There are always two letters in the genotype because (as a result of sexual reproduction) one code for the trait comes from mama organism & the other comes from papa organism, so every offspring gets two codes (two letters). There are three possible GENOTYPES - two big letters (like “AA"), one of each (“Aa"), or two lowercase letters (“aa"). Each possible combo has a term for it. There are three possible GENOTYPES - two big letters (like “AA"), one of each (“Aa"), or two lowercase letters (“aa"). Each possible combo has a term for it.

Mendel´s laws When we have two capital or two lowercase letters in the GENOTYPE (ex: AA or aa) it's calledHOMOZYGOUS ("homo" means "the same"). Sometimes the term "PURE" is used instead of homozygous. When we have two capital or two lowercase letters in the GENOTYPE (ex: AA or aa) it's calledHOMOZYGOUS ("homo" means "the same"). Sometimes the term "PURE" is used instead of homozygous. When the GENOTYPE is made up of one capital letter and one lowercase letter (ex: Aa) it's calledHETEROZYGOUS ("hetero" means "other"). A heterozygous genotype can also be referred to as HYBRID. When the GENOTYPE is made up of one capital letter and one lowercase letter (ex: Aa) it's calledHETEROZYGOUS ("hetero" means "other"). A heterozygous genotype can also be referred to as HYBRID.

Mendel´s laws PHENOTYPE = how the trait physically shows- up in the organism. PHENOTYPE = how the trait physically shows- up in the organism. ALLELES = alternative forms of the same gene. Alleles for a trait are located at corresponding positions on homologous chromosomes. ALLELES = alternative forms of the same gene. Alleles for a trait are located at corresponding positions on homologous chromosomes.

Mendel´s laws For example: For example: The gene A codifies for brown eyes and the gene a codifies for blue eyes. The gene A codifies for brown eyes and the gene a codifies for blue eyes. One individual whose genotype is AA will have brown eyes (phenotype). One individual whose genotype is AA will have brown eyes (phenotype). One individual whose genotype is aa will have blue eyes (phenotype). One individual whose genotype is aa will have blue eyes (phenotype). One individual whose genotype is Aa will have brown eyes (phenotype). This is because A is dominant and a is recessive. One individual whose genotype is Aa will have brown eyes (phenotype). This is because A is dominant and a is recessive.

Mendel´s laws

The Law of Dominance In a cross of parents that are pure for contrasting traits, only one form of the trait will appear in the next generation. Offspring, which are hybrid for the trait, will have only the dominant trait in the phenotype. The Law of Dominance In a cross of parents that are pure for contrasting traits, only one form of the trait will appear in the next generation. Offspring, which are hybrid for the trait, will have only the dominant trait in the phenotype. The Law of Segregation During the formation of gametes, the two alleles responsible for a trait separate from each other. Alleles for a trait are then "recombined" at fertilization, producing the genotype for the traits of the offspring. The Law of Segregation During the formation of gametes, the two alleles responsible for a trait separate from each other. Alleles for a trait are then "recombined" at fertilization, producing the genotype for the traits of the offspring. The Law of Independent Assortment Alleles for different traits are distributed to sex cells (& offspring) independently of one another. The Law of Independent Assortment Alleles for different traits are distributed to sex cells (& offspring) independently of one another.

Mendel´s laws One man with brown hair who is heterozygote (Aa) marries a woman with blonde hair (aa). What percentage of their children will have blonde hair? One man with brown hair who is heterozygote (Aa) marries a woman with blonde hair (aa). What percentage of their children will have blonde hair? A) 0% C) 50% A) 0% C) 50% B) 25% D) 75% E) 100% B) 25% D) 75% E) 100%

Mendel´s laws One man with albinism (aa) marries a woman with normal colour in her skin who is a homozygote (AA). What percentage of their children will have skin with normal colour? One man with albinism (aa) marries a woman with normal colour in her skin who is a homozygote (AA). What percentage of their children will have skin with normal colour? A) 0% C) 50% A) 0% C) 50% B) 25% D) 75% E) 100% B) 25% D) 75% E) 100%

Mendel´s laws Two people with familial hypercholesterolemia, who are both heterocygotes (Aa) marry. The gene that causes familial hypercholesterolemia is recessive. Calculate the percentage of their offspring that will have familial hypercholesterolemia. Two people with familial hypercholesterolemia, who are both heterocygotes (Aa) marry. The gene that causes familial hypercholesterolemia is recessive. Calculate the percentage of their offspring that will have familial hypercholesterolemia. A) 0% C) 50% A) 0% C) 50% B) 25% D) 75% E) 100% B) 25% D) 75% E) 100%

Mendel´s laws The Law of Independent Assortment Alleles for different traits are distributed to sex cells (& offspring) independently of one another. The Law of Independent Assortment Alleles for different traits are distributed to sex cells (& offspring) independently of one another.

Mendel´s laws

The third law of Mendel is only correct when the genes are in different pairs of homologous chromosomes. The third law of Mendel is only correct when the genes are in different pairs of homologous chromosomes. If genes are in the same pair of homologous chromosomes they are mantained together during meiosis (unless there is chromosomal crossover). If genes are in the same pair of homologous chromosomes they are mantained together during meiosis (unless there is chromosomal crossover).

Mendel´s laws

What are the types of gametes this individual will form? (Imagine there´s no chromosomal crossover for Aa and Bb in meiosis) What are the types of gametes this individual will form? (Imagine there´s no chromosomal crossover for Aa and Bb in meiosis) A) AB and ab A) AB and ab B) A, a, B and b B) A, a, B and b C) Aa and Bb C) Aa and Bb D) aB and Ab D) aB and Ab E) AB, Ab, aB and ab E) AB, Ab, aB and ab

Transcription It is the process in which DNA is copied into RNA. It is the process in which DNA is copied into RNA. Why is it necessary to do this? DNA carries information to synthesise proteins, but proteins are synthesised in the ribosomes, organelles that are on the cytoplasm, and the DNA is in the nucleus.

Transcription After the DNA is copied into RNA, the RNA can travel outside the nucleus and into the ribosomes so that proteins can be sythesised. (THIS IS WHY THE RNA THAT IS SYNTHESISED IS CALLED RNA MESSENGER, RNAm) After the DNA is copied into RNA, the RNA can travel outside the nucleus and into the ribosomes so that proteins can be sythesised. (THIS IS WHY THE RNA THAT IS SYNTHESISED IS CALLED RNA MESSENGER, RNAm) DNA is “read” in 3´-5´ direction and RNA is synthesised in 5´-3´ direction. DNA is “read” in 3´-5´ direction and RNA is synthesised in 5´-3´ direction.

Transcription What is the RNA that will be formed from this strand of DNA? What is the RNA that will be formed from this strand of DNA?3´-ATCCGGATTTCGGAACATCAGGGT-5´

Translation In this process the information of the RNAm is used to synthesise proteins. In this process the information of the RNAm is used to synthesise proteins. The RNAm travels from the nucleus, where the DNA is, to the ribosomes, where the proteins are synthesised. The RNAm travels from the nucleus, where the DNA is, to the ribosomes, where the proteins are synthesised.

Translation Proteins are formed by the repetition of units that are called amino acids. Proteins are formed by the repetition of units that are called amino acids. There are 20 different amino acids, so a lot of different proteins can be created, depending of the order of the amino acids that form the protein. There are 20 different amino acids, so a lot of different proteins can be created, depending of the order of the amino acids that form the protein. Each three bases on the RNAm codifies for one amino acid, using the genetic code. Each three bases on the RNAm codifies for one amino acid, using the genetic code.

Translation (genetic code)

Translation What is the sequence of the protein that is formed from this sequence of DNA? What is the sequence of the protein that is formed from this sequence of DNA? 3´-TACTGTCGAACACCAACT-5´ 3´-TACTGTCGAACACCAACT-5´