Graduate Research with Bioinformatics Research Mentors Nancy Warter-Perez, ECE Robert Vellanoweth Chem and Biochem Fellow Sean Caonguyen 8/20/08

What is Bioinformatics? According to the National Center for Biotechnology Information (NCBI): Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. The ultimate goal of the field is to enable the discovery of new biological insights as well as to create a global perspective from which unifying principles in biology can be discerned

Bioinformatics_doerge_080304%20(1)-sm.jpg Bioinformatics Overview

Some Bioinformatics Areas and Tools Genome assembly – DNA Sequencing program Sequence alignment – Multiple Sequence Alignment Programs Genetic engineering – Primer designing for DNA replication Protein prediction – SWISS-MODEL Protein structural alignment Molecular modeling Protein interactions / _DNA_over_computer_keyboard.png

Bioinformatics Approaches / _DNA_over_computer_keyboard.png Computer Scientist – Develop tools to help solve problem posed by biologist/chemist Biologist/Chemist – Use (and perhaps extend) Bioinformatics tools to Analyze and visualize your results Compare your data to existing data in online databases Help make predictions to be verified through biological experimentation

Sean’s Graduate Research Dr. Vellanoweth’s Lab Research on a flowering plant species called Arabidopsis thaliana Studies aging process in plants to improve agricultural techniques Focuses on lipid transfer proteins may signal during the aging process of the plant

History of Arabidopsis Model system for plant molecular genetics Small size – Space efficient – Smallest known plant genome (125Mbps) – Good for experimentation Grows fast – Produces thousands of seeds – Short Life Cycle

Life Cycle of Arabidopsis

Bioinformatics_doerge_080304%20(1)-sm.jpg Bioinformatics Overview

Study plant gene evolution Compare LTP genes across different species of plants – Rice (Oryza sativa) is distantly related to the Arabidopsis plant Analysis of LTP against the rice genome Look for possible Arabidopsis related LTP family genes in rice Bioinformatic approach to Research

Multiple Sequence Alignment of the LTP gene from Different Species AGCAAACAAACACACACATCCAACG CACATCCAACAGGAACACAAACACA CACAACAACACCACATCCAAAAGAG Seq1 Seq 2 Seq 3

atLTP Phylogentic Tree in Rice Arabidopsis thaliana LTP

Bioinformatics Training / _DNA_over_computer_keyboard.png Chem 434 – Bioinformatics – Teaches students from both disciplines how to use and develop bioinformatics tools SoCalBSI – NIH/NSF Southern California Bioinformatics Summer Institute – 10 week summer program to train students from around country (3 wk didactic & 7 wk internship) – In our 6 th year

Expression Pattern Analysis Microarray technology is a powerful tool for investigating cellular activity at different levels DNA microarrays can be used to identify genetic ‘‘signatures’’ for disease 07/09/ jpg Pan et al. (2005)

Analyzing Microarray Data A B D E F C P G A D F P B

Bioinformatics