Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

Chapter 12 Section 3 RNA and Protein Synthesis

Objectives Tell how RNA differs from DNA Tell how RNA differs from DNA Name the 3 main types of RNA Name the 3 main types of RNA Describe transcription and the editing of RNA Describe transcription and the editing of RNA Identify the genetic code Identify the genetic code Summarize translation Summarize translation Explain the relationship between genes and proteins. Explain the relationship between genes and proteins.

Genes Coded DNA instructions that control the production of proteins within the cell. Coded DNA instructions that control the production of proteins within the cell. Decoding the message: DNA is copied into RNA, and RNA transports the message to be encoded. Decoding the message: DNA is copied into RNA, and RNA transports the message to be encoded.

The Structure of RNA Long chain of nucleotides Long chain of nucleotides RNA Nucleotide: RNA Nucleotide: Ribose Ribose Phosphate Phosphate Base: A, G, C, and URACIL (U) instead of T Base: A, G, C, and URACIL (U) instead of T SINGLE-stranded SINGLE-stranded

Types of RNA 3 Main Types 3 Main Types Messenger RNA (mRNA): carries copies of DNA instructions Messenger RNA (mRNA): carries copies of DNA instructions Ribosomal RNA (rRNA): makes up the structure of ribosomes. Ribosomal RNA (rRNA): makes up the structure of ribosomes. Transfer RNA (tRNA): transfers each amino acid to the ribosome during protein synthesis Transfer RNA (tRNA): transfers each amino acid to the ribosome during protein synthesis

Transcription DNA  RNA DNA  RNA Requires RNA polymerase Requires RNA polymeraseProcess: 1. RNA polymerase binds to DNA and separates strands. 2. RNA polymerase uses DNA template to assemble nucleotides in a new strand.

***HOW does RNA polymerase know where to start in the DNA sequence? RNA binds to PROMOTERS in DNA, which have specific base sequences.

RNA Editing DNA contains two types of sequences: DNA contains two types of sequences: Introns: not involved in coding for proteins Introns: not involved in coding for proteins Exons: “EXpressed” in the synthesis of proteins. Exons: “EXpressed” in the synthesis of proteins. After RNA is made from DNA, it is edited. After RNA is made from DNA, it is edited. Introns are cut out Introns are cut out Cap and tail are added to ends of RNA Cap and tail are added to ends of RNA

The Genetic Code Proteins: made by joining amino acids into long chains called polypeptides. Proteins: made by joining amino acids into long chains called polypeptides. Each polypeptide contains a combination of any or all of the 20 amino acids. Each polypeptide contains a combination of any or all of the 20 amino acids. mRNA carries the genetic code (made from DNA) mRNA carries the genetic code (made from DNA) Code is language of 4 letters (A,U,C,G) Code is language of 4 letters (A,U,C,G) Letters read 3 at a time (CODON) Letters read 3 at a time (CODON)

Example: Example: UCGCACGGU UCGCACGGU Read 3 bases at a time: UCG-CAC-GGU Codons represent amino acids: Serine-Histidine-Glycine *64 Possible 3-base codons.

“ Start” codon: AUG (methionine) “ Start” codon: AUG (methionine) “Stop” codons: UGA, UAA, UAG “Stop” codons: UGA, UAA, UAG

Translation mRNA  Protein mRNA  Protein Information from mRNA is used to make proteins. Information from mRNA is used to make proteins.

Steps of Protein Synthesis  change 1. TRANSCRIPTION: mRNA is made from DNA (in nucleus) 2. mRNA leaves nucleus and attaches to ribosome.

3. mRNA moves through ribosome, and tRNA brings amino acids being “coded” for. (tRNA has “anti-codons” that are complimentary to mRNA codons at one end, and amino acids coded for by mRNA at the other end. 4. As tRNA attaches to mRNA, amino acids at tops of tRNA’s attach to each other.

5. Amino acid chain (polypeptide chain) continues to grow until a stop codon is reached. When protein is complete, it is released from the ribosome.

Roles of DNA and RNA -DNA: has the “master plan,” and remains in the nucleus. -RNA: has the “blueprints,” and goes to the site of protein synthesis.

Genes and Proteins ** Most proteins are enzymes that catalyze reactions. **Genes can regulate the rate and pattern of growth through an organism, control its size and shape, produce pigments, etc.

DNA: TACGGCGTGAGACCCAGCTGA mRNA:tRNA: Amino Acids: (read mRNA)