1. Biology Resources Set 2: Answers for Structured Note-Taking

2. 5 Biology- The study of living things Who: Biologist - Interactions between living things - Interactions between living things and the environment - Problems to find solutions Living thing-organism 5 Characteristics: 1. Cells & DNA 2. Reproduce 3.Grow & Develop 4. Homeostasis 5. Adapt 1. Cells & DNA Cell- basic unit of life DNA- genetic info 2. Reproduce *to further the species 3. 4. homeostasis *internal balance (kidneys sweating) Without it, you will die! 5. Adapt Adaptation : help you survive in environment Evolution: change in species over time GrowDevelop Become largerMature, become like an adult Species: group of similar organisms that can interbreed and have fertile offspring

3. SCIENTIFIC METHOD- a series of steps to solve a scientific problem 1. Problem 2. Hypothesis 3. Experiment 4. Data 5. Results 6. Conclusion 7. R/R or Repeat ----------------------------------- 1. Problem- scientific * Cannot be opinion * Give ex of opinion vs scientific 2. Hypothesis- a testable statement *give example 3. Experiment -a test of a hypothesis Independent variable: tested Dependent variable: measured Constant: same Control: normal to measure against 4. Data- info collected 5. Results- charts/graphs 6. Conclusion 7. Revise / Redo or Repeat - R/R- hypo wrong - Repeat- hypo right Why repeat: to verify results 7 QuantitativeQualitative - n - numbers - 5 ft, 7.2 inch - L - letters, words, descriptive

4. WATER Properties: Polar- Great solvent --Like dissolves like-- --Polar dissolves polar-- Non-polar= oils, fats - will not dissolve Hydrogen Bonds: - gives H2O special properties - make/break rapidly 3 Things H2O does: 1. Capillary action Good- H2O to tops of trees 2. Stabilizes temp, holds heat (Good) NC ocean- mild climate Desert- hot day, freezing night 3. Expands when freezes – less dense Good- floats Water does these things because of Hydrogen bonds Water is Polar

5. ACID pH: 1-7 Gives- H+  burns Ex: lemon juice, stomach acid BASE pH: 7-14 Gives- OH-  Soapy, cleaning Ex: cleaners, ammonia pH scaleBuffer 7 Neutral H2O Maintains constant pH Ex. Blood buffer

6. ORGANICORGANIC Organic = has Carbon  Living things have C [S]-[U]-[G]-[A]-[R] CARBOHYDRATES  Polymer- polysaccharide  Monomer- monosaccharide Uses  quick Energy Ex. Starch, sugar, fiber Foods  plant products/ fruit, veggies Polymer long chain of repeating units Ex.train [o]—[o]---[o]---[o] Monomer one unit Ex. Train car [o] 4 Classes of organics Carbs Protein Nucleic Acid Lipid P R O T E I N (A)-(M)-(I)-(N)-(O)-(A)-(C)-(I)-(D) Polymer- polypeptide (protein) Monomer- amino acid Uses  hair skin enzymes Food  animal products, beans Ex. Enzymes (go to enzyme side)

7. Nucleic AcidEnzymes Monomer- nucleotide Ex. – DNA/RNA Importance  genetic info LIPID fats and oils nonpolar Meaning  will not dissolve in H2O Found in  mayonnaise, butter Greasy, oily A type of protein Subunit of protein amino acid Job- “Biological Catalyst” Affected by: temp & pH Needed for: Biological Functions Lock and Key Model E are not consumed/used Inout

8. Before Microscopes: sick because cursed or punished for bad deed MICROSCOPESMICROSCOPES Microscope  tool used to look at small organisms Micro – small Scope – to look at Microscopes allow US to see cells! Cell  basic unit of life Microscope Types: 1.Simple light – 1st type 1 lens Energy Source light LOW magnification power 2. Compound Light 2+ lenses Energy source light Lens= 10Objective = 4 Total Magnification = 40 Up to about 1500 X’s 3.Electron Microscopes Uses beam of electrons Magnify up to 500,000 X’s SEM scanning e- microscope surface TEM transmission e- microscope inside

9. Match the part with the letter Parts: Objectives, Diaphragm, Lens, Coarse Adjustment, Light Source, Arm, Stage, Fine Adjustment Answer Questions using Parts 1. __D__Used to bring objects into rapid focus first 2. __F__ Regulates the amount of light going through slide 3. __H__ Used to carry the microscope 4. __E__ Supports the slide 5. __A__ Turned to clear blurry pictures Answer Questions: How do you carry a microscope?- by the arm If the lens is 10 and the objective is 4, what is the total magnification?- 40 A.Fine AdjustmentE. Stage B.LensF. Diaphragm C.Light SourceG. Objectives D.Coarse AdjustmentH. Arm

10. CELL THEORYCELL THEORY Famous Men Leeuwenhoek: saw microorganisms Used a simple microscope Robert Hooke : named a cell Used a compound microscope Looked at cork- Reminded him of rooms in a monastery  Called cells T. Schwann: sounds like Swan All animals made of cells M. Schleiden: All plants made of cells Since all plants and animals are made of cells they concluded that… Hooke, Schleiden, Schwann Cells Plants Animals CELL THEORY 1. All living things are made of cells unicellular- 1 cell multicellular- 2+ cells 2. Cell is the basic unit of life The beginning unit is always a cell 3. All cells come from other cells muscleskin muscle cells tissue organ Organ system organisms

11. PLASMAMEMBRANEPLASMAMEMBRANE Plasma Membrane Structure Plasma Membrane  outer boundary of a cell - skin Job- to maintain homeostasis Homeostasis  internal balance PM is selectively permeable selectively- choosy Permeable – allows to pass Selectively permeable  chooses what it allows to pass balanced Good in Bad out PM Polar head Tails non-polar (hydrophobic) phospholipids bilayer Polar: heads outside Non-polar: tails inside hiding from H2O Fluid mosaic model  flexible  Embedded w/ protein Perm mem nucleus

12. CELLSCELLS Cell organelles  organs in a cell “organelle“ Most important = nucleus Nucleus  controls all cell function Nucleus:Cell :: brain:body 2 Cell Types Prokaryote Eukaryote Animal cell nucleus int membrane complex multitask plants/animals no nucleus no int membrane simple 1 job at a time bacteria only Internal Membranes  separate the cell into compartments Membranes : Cell :: walls: School Jobs – separate -divide -allow to multiply nucleus prokaryote eukaryote

13. CELLSCELLS Cell Theory 1.All living things made of cells 2. Cell is basic unit of life 3.All cells come from pre-existing cells Prokaryote Eukaryote simple no nucleus no interior membrane complex nucleus int membrane Nucleus: controls all cell function Internal Membrane: separate cell into rooms Relating factor: RF: divide Nucleus is to cell as Brain is to body Int mem is to cell as Wall is to school Plasma Membrane Plasma membrane is to cell as Skin is to body RF: center covering Job: homeostasis Structure: phospholipids bilayer “ fluid mosaic model” Polar heads outside Nonpolar tails inside away from water Other Cell Organelles Cell wall is to cell as Helmet is to head RF: hard protection Cell wall  hard exterior covering Made of: cellulose Gives: extra protection Note  plants only

14. ribosome is to cell as Protein factory is to city RF: makes protein Ribosome: 2 types: free bound Job  make protein *You can’t live without PROTEIN* Chloroplast is to cell as Kitchen is to house RF: room to make food Chloroplast: Description- green job- make food/ photosynthesis Chlorophyll- traps sunlight NOTE  plants only Vacuole is to cell as Fridge is to house RF: stores Mitochondria is to cell as Battery is to object RF: energy Eukaryotes: Have membrane bound organelles Have nucleus Vacuole: Description- empty sac job- store food, H2O NOTE  plant cell larger Mitochondria: makes energy ATP *You can’t live without ENERGY!!* ATP Prokaryotes: Have plasma membrane Have DNA Have Ribs b/c  must have protein

15. DIFFUSIONDIFFUSION Concentration: Amount of solute in solution. Think kool-aid Highlow Lots of solutenot enough solute Solute (green) will move from high to low AB Solute (green) will move to B (think elevators and buffet lines. Where would you rather be?) Goal: Concentration Dynamic Gradient Equilibrium difference in conc on sides 7/3 equal 5/5 To side A To side B A A A A B B BB

16. OSMOSISOSMOSIS Which side needs to be diluted? A So water will go to side A Water will move to side B Why? To dilute high More water on side A because more particles Remember Diffusion  movement of a solute to low (less crowded) Driven by: concentration gradient Result: DE Review concentration: (think kool-aid) HighLow Too muchnot enough Dilute  add water to lower conc. OSMOSIS movement of water to high Why: to dilute Driven by: CG Result: DE

17. CELL OSMOSISCELL OSMOSIS Water will move to side A Why? To dilute Where is there more? in So water flows? in Results: swells  Puts pressure on inside wall More : out Water flows: out Result: shrivels Sides: equal So: no flow Result: no pressure 9 2 3 3 6 3 HypotonicHypertonic Isotonic SwellsShrivels Squishy fruit Swells, could burst Shrivels Animals homeost asis inoutequal 374 Water Flows Cell Animal Plant 824

18. TRANSPORTTRANSPORT Passive no energy Happens because there is a Concentration gradient Result- dynamic equilibrium 1. Diffusion 2. Osmosis 3. Facilitated Diffusion Active uses energy Requires energy to: move against conc grad Result: more unequal 1. pumps 2. carriers 3. endocytosis, exocytosis Passive: to side B Active: pumped to side A AB

19. Cell cycle  cycle for cells to make new cells “All cells come from pre-existing cells”  Cells must reproduce DNA in cells  chromatin unpacked  chromosome packed DNA visible when stained MITOSISMITOSIS Cell cycle: 1. Interphase: grow & DNA duplicate 2. Mitosis: nucleus divides 3. Cytokinesis: cut cell in half centromere Sister chromatids

20. ENERGYENERGY # 1 Source of energy- sun Cell energy- ATP “Adenosine Triphosphate” A – P – P – P Release Energy  break bond Store Energy  make bond Remove –P leaves A–P-P (ADP) Remove –P leaves A – P (AMP) Which has more energy? ATP Why? More P-P bonds *Made in the mitochondria Photosynthesis Who  plants Where  chloroplast Job- to make food + O2 Plants take InOut CO2-O2 water H2O-food sun E Reactant in Product out Eq: 6CO 2 +6H 2 O+E  6O 2 +C 6 H 12 O 6 Sun  chemical  food E E E C6H12O6

21. Cellular Respiration Where  mitochondria Job  to make ATP In O 2 C 6 H 12 O 6 Out CO 2 H 2 O E-ATP Reactant IN Product OUT Eq: 6O 2 +C 6 H 12 O 6  6CO 2 +6H 2 O+E Notice: Products of PS are reactants in CR Cellular respiration photosynthesis food O2 AerobicAnaerobic OxygenNo oxygen Makes 32+ ATP Makes 2-3 ATP Also called fermentation Lactic Acid Fermentation  Alcoholic Fermentation  CO 2

22. Chemistry and Cell Review “polar“ AcidBase OrganicMonomerNotes and examples 1 carbMonosaccharide sugar 2 proteinAmino acid 3 nucleic acidnucleotide 4 lipid----------- Parts of cell theory all living things made of cells the cell is the basic unit of life all cells made from pre-existing cells Leeuwenhoek: saw microorganismsHooke: saw cells Scleiden: all plants made of cellsSchwann: all animals made of cells pH 1-7 H+, burns pH 7-14 OH-, cleans

23. PlantAnimalProkaryoteEukaryote Chloroplast Cell wall Larger vacuole No chloroplast No cell wall Small vacuole No nucleus PM Ribosomes DNA Nucleus Other organelles Cells  basic unit of life Cell  tissue  organ  organ system  organism Cell Parts Nucleus– control Plasma Membrane- outer covering Mitochondria- energy Chloroplast- food- photosynthesis Ribosome- protein Vacuole- store food

24. ActivePassive Energy Makes more equal No energy, makes equal Diffusion, osmosis Facilitated diffusion Solute will move to B Why- less concentrated Result- dyn eq Process- diffusion Water will flow to A Why- needs to dilute Result- dyn eq Process- osmosis 735 285 Water goes: in - swell Water goes: out - shrivel Water goes: no flow - stable AB Concentration GradientDynamic Equilibrium Difference in conc gradEqual on both sides

25. Place the phases in order: D A F C E B and name them A B C DE F Cell Energy  ATP Adenosine triphosphate - Energy stored in P-P bonds mitochondria Photosynthesis INOUT H2O, CO2, E O2, C6H12O6 Eq: 6CO 2 +6H 2 O+E  6O 2 +C 6 H 12 O 6 Chloroplast Aerobic Oxygen, more ATP Cellular Respiration We breathe in O2 We eat C 6 H 12 O 6 We breathe out CO2 Make H2O + ATP Anaerobic No oxygen, less ATP fermentation TeleMetaMom AnaProp

26. DNADNA GENETIC CODEGENETIC CODE DNA – deoxyribonucleic acid Codes for  genetic info Gives info to make protein Importance of protein: can’t live without protein codes for traits (eye color, hair) DNA is very important information Where  nucleus Question- An enzyme helicase cuts segments of DNA to repair damaged cells. Where in the cell is this enzyme located?  nucleus Note  DNA cannot leave nucleus Structure Polymer = DNA -long chain of joining subunits Subunit  nucleotide Nucleotide (3 parts) 1. Sugar deoxyribose 2. phosphate 3. Nitrogen bases (4) Nitrogen bases (4) 1. Adenine A3. Cytosine C 2. Guanine G4. Thyamine T Purinespyrimidines Ad Gua Cy Thy

27. --T --C --A --G --T --A Important structure note: DNA is a double helix Watson & Crick  men 2 strands Like a ladder  backbone Repeating  S-P-S-P-S-P Nitrogen bases Complementary bases they always go together A= TC= G Hydrogen bonds Bases always held together by hydrogen bonds  So DNA looks like this Backbone S-P-S-P Bases held together by hydrogen bonds A-- G- T- C- A-- T-- ?-- Make the DNA complement

28. REPLICATIONREPLICATION Review Make the complement: 1.ATCTAAGCAGGTA TAGATTCGTCCAT 2.TACGGATACCGAAT ATGCCTATGGCTTA Replication DNA synthesis  make DNA Word Attack: Synthesis  to make Replication makes a copy Why  for new cells When  interphase Where  nucleus How: 1.Enzyme splits it 2.Complement strands made Result  Replication makes a copy DNA codes for protein Proteins made on ribs Problem  DNA cannot leave nucleus Info must get to the nucleus Solution  RNA

29. Review: RNA – ribonucleic acid 1 Strand Nucleotide (3) 1.Sugar ribose 2.phosphate 3.Nitrogen base * A *G *C * U (uracil) A  U C  G Made by transcription Transcription  Makes RNA from DNA Where: nucleus RNARNA Transcription DNA- ATCGTATCA RNA- UAGCAUAGU DNA- TACCGATCCCATC RNA- AUGGCUAGGGUAG DNA- GACCCGTCATCCGGTAATAATCCAT RNA- CUGGGCAGUAGGCCAUUAUUAGGUAU DNA RNA. deoxyribonucleic acid 2 strands deoxyribose sugar Bases A=T G=C made by replication cannot leave nucleus ribonucleic acid 1 strand ribose sugar bases A=U C=G made by transcription nucleus- ribosome

30. Review: DNA RNA. Bases- AT, CGBases-AU, CG Process-replication Process- transcription Job  to make protein Protein  a long chain of amino acids Process  translation Translation  to make protein by joining amino acids PROTEINPROTEIN How to find out what amino acids to use: 1.Use chart 2.Use codons Codon  set of 3 nb used to code for AA Let’s Practice! CAU – His UUU –Phe UUA – Leu GAA – Glu CCC – Pro CGC – Arg Does chart use RNA or DNA? RNA So If you have CAT? GUA

31. TRANSLATIONTRANSLATION Remember DNA RNA. deoxyribose 2 strands AT CG replication cannot leave nucleus ribose 1 strand AU CG transcription nucleus- ribosomes A = T (DNA) A = U (RNA) C= G 3 parts of a nucleotide: 1. sugar 2. phosphate 3. Nitrogen base Replicate: ATCCATGAACTATAG TAGGTACTTGATATC Transcribe: ATCCATGAACTATAG UAGGUACUUGAUAUC 3 types RNA: 1. mRNA: messenger 2. tRNA: transfer 3. rRNA: ribosomal Protein monomer amino acid Codon: set of 3 nb Translation  make protein Ex: ACU I GUU I CAU 1.Divide into 3’s 2.2. Find amino acid on chart Protein  Thr – Val – His Ex: TAC GAA CCC GTA CAA ACT –DNA AUG CUU GGG CAU GUU UGA -RNA protein

32. MUTATIONMUTATION Review: 1.Make the DNA complement: CATGACTTAATGCGA GTACTGAATTACGCT 2. Transcribe: CATGACTTAATGCGA GUACUGAAUUACGCU 3.Translate: CAT GAC TTA ATG CGA GUA CUG AAU UAC GCU RNA mRNA- MESSENGER tRNA – TRANSFER rRNA – RIBOSOMAL THE DOG BIT THE CAT 1.THE DOG BIT THE CAR 2.TED OGB ITT HEC AT_ 1  Point-Substitute: changes 1 amino acid 2  Frameshift: delete/insert. Changes all amino acids

33. DNA Mini Lab Normal hemoglobin vs. Sickled hemoglobin Normal hemoglobin carries oxygen Sickled hemoglobin cannot carry oxygen Why  They make different proteins Job: Transcribe and translate the DNA of the 2 types of hemoglobin Normal: GGG CTT CTT TTT Sickled: GGG CAT CTT TTT Using AAT GCC AGT GGT TCC CAC what protein would it make? Contrast replication, transcription and translation: Contrast RNA and DNA: What are the 3 parts of a nucleotide?

35. GENETICSGENETICS Father of Genetics: Gregor Mendel Heredity: passing of traits from parents to kids Genetics: study of heredity Traits: characteristics you get from parents Gametes: sex cells MomDad Eggsperm Fertilization- union of sperm and egg Zygote – fertilized egg Gene: segment of DNA that codes for a protein/trait Allele: choices for a trait/gene Ex: gene- eye color gene- height Alleles- brown, blue alleles- tall short DominantRecessive Law of Segregation: Get 1 allele for each trait from each parent So you end up with – 2 alleles for each Always seen T Can be hidden and skip generations t

36. Since you have 2 alleles for each gene, you have 2 letters (Remember baby lab) TT  homozygous dominant (Tall) Tt  homozygous recessive (short) Tt  heterozygous (tall) Big letter ALWAYS wins GenotypePhenotype How do you predict what offspring will look like?  Punnet Square Tool used to predict genotype and phenotype of offspring B=black b=tan Mom - BbDad- BbLooks black Cross parents Bb x Bb momdad 1.Draw box 2.Put mom gametes on top. Put Dad gametes on side. 3.Fill in box with a letter from each parent 4.Analyze BBBb bb BbBb BbBb Combo of alleles Tt Bb Physical trait Tall, short

37. Dihybrid Crosses 2 different traits/parent B = brown b = white T = tallt = short BbTt – brown tall Bbtt - brown short bbTT - white tall BBtt -white short Rules for dihybrids Ex: BbTb x Bb TT 1.Label mom and dad Mom- BbTt dad BbTT 2. Take mom and label letters 1-4 BbTt 1234 3.Pair up letters in the following combinations BbTt 1234 1,3 1,4 2,3 2,4 BT Bt bT bt Notice: never 2 of the same letter in a pair 4.Repeat for Dad BbTT 1,3 1,4 2,3 2,4 BT BT bT bT 5. Draw Punnet square How many squares will you have? BbTt x BbTT 4 X 4 = 16

38. BTBtbTBt BTBBTTBBTtBbTTBbTt BTBBTTBBTtBbTTBbTt bTBbTTBbTtbbTTbbTt bTBbTTBbTtbbTTbbTt Square: 4 across, 4 down 6.Place Mom’s 4 combos on top 7.Place Dad’s 4 conbos down side 8.Fill in boxes Each box will have 4 letters Using our example how many offspring will be: BBTT: 2BBTt: 4 bbTt: 2BbTt: 4 BbTT: 4 Brown tall: 12white tall: 4 TR tR TRTTRR TtRR TrTTRr TtRr tRTtRR ttRR trTtRr ttRr Q1: T – tall t – short R – round r – white TtRR x TtRr How many are tall round? 12 What are the genotypes? TTRRTtRR TTRrTtRr ttRRttRr Remember combos: 1,3 1,4 2,3 2,4

39. GENETIC TECHNOLOGYGENETIC TECHNOLOGY Uses: 1.Forensics 2.DNA obtained from: If know DNA sequences: Other uses of Genetic Technology: 1.Industry 2.Medicine 3.Agriculture

40. PEDIGREEPEDIGREE Pedigree: a genetic family Carrier: Tt – carries the t but is not affected by it How is person 7 kin to person 1? Son InLaw How are 6 and 9 kin? Aunt/nephew How is 1 kin to 13? Great grandson How many males? 6 Females? 7 How many affected people? 5 Males? 3 Females? 2 If trait studied is tt – short: Give the gen/phen for each person 1 Tt tall8 tt short 2 Tt tall9 Tt tall 3 Tt tall10 Tt tall 4 Tt tall11 tt short 5 tt short12 Tt tall 6 Tt tall13 tt short 7 tt short Persons _5,7,8,11,13_ are short male female affected married children carrier

41. Practice Pedigrees: Which people are affected? 3, 6 Label each person bb- blue BB or Bb - brown This is a recessive pedigree Because  2 unshaded parents have an affected child Most genetic disorders are caused by: 2 recessive alleles Recessive Diseases: Cystic Fibrosis: -Buildup of mucous in lungs Pedigree: Note: only child affected For a recessive disease to affect a child both parents must be: carriers Carrier: carries the allele but are not sick Cc What % Chance will 2 carrier parents have a sick child? 25%

42. HUMAN TRAITSHUMAN TRAITS Most genetic disorders are caused by 2 recessive alleles Cystic Fibrosis: -A buildup of mucous in lungs -Affects mostly children Tay-Sachs -affects the brain -Cannot break down lipid/fat -Mostly affects children PKU -found in protein -cannot digest protein - Controlled by diet Dominant Traits: Hitchhiker thumb Unattached ear lobes Thick lips Huntington’s Disease: Causes brain degeneration Affects people 35 to 45 Why do people with Huntington’s have children not know they are sick If you carry the gene for Huntington’s you are affected by it H = has it h = does not

43. 1. Which is Huntington’s? A Which is cystic fibrosis? B How do you know? 2.How is Huntington’s different? Older age, dominant 3.Define the following: 4.What body part is affected by CF? lungs 5.If a child with free hanging earlobes has a mother with attached earlobes, could a man with attached earlobes be the father? No Why? No big F’s to give F = freef = attached 6. # affected: 6 How are 9 and 6 kin? aunt Gen/phen of person: 2 ff att7 Ff 3 Ff9 Ff 4 ff att11 Ff 13 ff att malefemale marriedcarrier

44. Blood Type- codominance and multiple alleles Multiple alleles  more than 2 choices TypeGenotype AI A I A I A I i BI B I B I Bi ABI A I B Oii Who did the blood bank  Charles Drew  blood transfers If a son has blood type O could a msn with blood type B be Dad if the Mom has A? What % chance do an A (Ia,i) woman and a B (Ibi) man have of having an O child?

45. Humans have 46 Into 23 pairs Karyotype  chart of paired chromosomes 23 rd pair - sex chromosomes XX - female XY - male The chart shows a normal female CHROMOSOMESCHROMOSOMES Chromosomal Diseases: Down’s Syndrome  3 on 21 st pair -mental and physical retardation D-Smale 23 Monosomy 23 female copy

46. Sex-linked diseases Female – XX Male - XY Travel on the X Red/Green colorblindness Hemophilia: bleeder. Cannot clot blood Pedigree: Notice: mom is carrier. Passes it to sons More males affected Why? FemaleMale XxXXxY Can a carrier female and an affected male have an affected daughter? Can a normal female and an affected male have an affected daughter? 0 Son? 0 Where does a son get his bad X? mom Who does dad give his bad X to? daughter Good X takes over Only 1 X and it’s affected

47. Primitive Earth Deadly Gases Primitive Earth: NO LIFE How did life begin? ORIGIN OF LIFEORIGIN OF LIFE Oparin Hypothesis 3.9 billion years ago  This caused  2 things happened: 1. 2. Lightning and carbon in ocean formed: These combined to form _________ Protocell (organic)  _________ (simple)  ___________ (complex)

48. Urey and Miller  Can Oparin be for real? Urey and Miller tested him. How? Result  they found … Urey and Miller support Oparin Hypothesis  Where: in the __________ Evidence for Evolution 1.Fossils- oldest _________ fossil record  2.Biochemistry – 3.Embryology – 4.Anatomical Structures similarvestigial

49. ECOLOGYECOLOGY 1. Organism - 1 living thing Ex. 1 giraffe 2. group - 2+ of same species Ex.giraffes 3. community - 2+ different species Ex. Zebras and giraffes 4. ecosystem - Living and nonliving Ex. Zebra, giraffe, tree, and sun 5. biosphere - Can support life Ex. Sphere = circle Bio = life EARTH! 5 Ecology: the study of organisms and their environment Who? ecologist Biotic factors abiotic factors 5 levels of ecology: organism population community ecosystem biosphere Living Plants, animals, predators Nonliving Sun, dirt, temp

50. Interactions: 1.Competition- fighting over resources HabitatNiche. Where it lives Ex. In a tree Reduces competition: by having organisms w/ diff niches/needs 2.Predator/Prey Predator: eats Prey: gets eaten Cyclic Prey up, predator up, then prey gets eaten, levels down, predator down from lack of food, then back to beginning as prey makes comeback Density dependent  depends on size of population 3.Symbiosis  living together, nothing dies Mutualism: 2 (both) benefit Ex. Fish in coral Commensalism : 1 benefit, 1 unaffected :l Parasitism: 1 benefit, 1 harmed  Ex. Leeches on a host What it does- job Ex. Collect acorns

51. BIOMESBIOMES AquaticTerrestrial Aquatic SaltwaterFreshwater OceanPond, lake PhoticAphotic Plankton/Phytoplankton- Terrestrial tundra taiga Temp forest grassland desert TRF North pole equator temp 2 most important factors 1. temp 2. precip TundraTaiga - coldest -permafrost: -ground perma- nently frozen -little veg’s -furry animals Temperate ForestGrassland - mod. Temp, rain -deciduous: lose Leaves in winter -seasonal DesertTropical Rain Forest -hot -arid-dry -conserve H2O -Nocturnal: sleep in day -Burrow: in ground Waterland Light shallow No light deep Northern coniferous forest -cold -snowy -conifer: evergreen trees, makes cones -mod temp/rain -grazing animals -crops- corn, wheat -hot -rainy -most plants -year round growing seasons -most biodiversity

52. BIOME PROJECT Instructions: Create a brochure, booklet, or PowerPoint to illustrate the characteristics of your biome. Be sure to include all required information and be neat and creative. Due Date: ________ Grading Criteria: _______ Name of Biome (5 pts) _______ Definition of Biome (5 pts) _______ Map of earth identifying the biome (5 pts) _______ Climate (including temperature, rainfall, seasons, etc) (6 pts) _______ Why is this biome different from the others? (3 pts) _______ Plants (2 = 2 pts, 3-4 = 3 pts, 5 = 4 pts 6+ = 5 pts) _______ Animals (2 = 2 pts, 3-4 = 3 pts, 5 = 4 pts 6+ = 5 pts) _______ Adaptations needed to survive (3 pts) _______ Food web of the biome (chain=2 pts, 5 step web =3 pts, 7+ step web= 5 pts) _______ Positive/Negative Affects Man has had on biome (2 pts each) _______ Include graphs where needed (0=0 pts, 1=1 pts, 2=2 pts, 3+=3 pts) _______ Include illustrations where appropriate (0=0 pts, 1-2= 1 pt, 3-4= 2 pts, 5+=3 pts) _______ Creativity and Neatness and Color (5 pts) _______ Bibliography (at least two books from the library) (10 pts) _______ Grade (65 point max) Be sure your project is colorful and that you have used proper spelling and grammar. Graphs and pictures should be used where needed to support your information. Please feel free to include any other interesting facts about your biome. Try your best and gather the needed information.

53. LIMITS & CHANGESLIMITS & CHANGES Limiting factor: anything that prevents some things from living in an area Abiotic: temp, rain, soil Biotic: food, predators Adaptation  something an organism has to survive in the environment Tolerance  ability to withstand change Population growth: carrying capacity levels off S-curve Carrying Capacity: max amount of individuals the environment can support Above cc  too many, some die Below cc  room for more Succession  changes in a community PrimarySecondary Order 1 pioneer species (lichen/moss) 2 grasses 3 bushes 4 pine trees 5 hardwood trees New place Slow Pioneer species After disaster (forest fire) Faster b/c already has life and soil Slow in beginning, speeds up

54. ENERGYENERGY All living things must have energy in order to maintain homeostasis #1 Energy Source= SUN Autotroph makes own food, get E from sun photosynthesis Ex. plants autotrophs= producers Heterotroph eat food for energy cannot make E Ex. animals Heterotrophs = consumers Types of heterotrophs 1.Herbivore: eats plants Ex. Deer, cows 2. Carnivore: eats meat Ex. lions 3. Omnivore: eats both Ex. Bear- berry, fish 4. Scavengers: eat dead stuff Ex. buzzards 5. Decomposers: biodegrade things Ex. Bacteria in a dumpster

55. Only 10 percent of energy goes to the next level. The rest is either used or lost as heat. As move up the pyramid energy is lost so the amount of energy decreases. Must be replaced by the sun. SUN Trophic Level = Energy Level. 1 st trophic level. Autotroph- plant. Producer. 2 nd trophic level. 1 st heterotroph. Herbivore- eats plants 3 rd trophic level. 2 nd heterotroph. Carnivore- eats herbivore 4 th trophic level. 3 rd heterotroph. Carnivore- eats carnivores Scavengers, decomposers

56. Matter is Recycled Water Cycle MATTERMATTER B D C A A: evaporation B: condensation C: precipitation D: transpiration Carbon – CO2 a. Plants take in CO2 “photosynthesis” b. We breathe in O2 from plant c. We eat food from plant d. We breathe out CO2 “cellular respiration” Pollution  bad CO2 into air CO 2 O2O2 Food A B C D

57. THREATSTHREATS Extinct EndangeredThreatened Threats Habitat Loss- remove habitat Effect- no place to live Ex. deforestation Habitat Fragmentation- separate Effects- edge effect encroachment Habitat Degradation- to make unlivable -pollution Effects: acid precipitation- lower pH of water less ozone- more harmful UV rays more CO2 greenhouse effect CO2 traps heat greenhouse/ global warming Exotic Species do not belong no predators reproduce and spread out of control 0 No more living Numbers close to 0 Decrease in population

58. CONSERVATIONCONSERVATION Conservation Biology- to save biodiversity Legal - CITES - US endangered species act Preservation - parks- Yellowstone - preserves - Sustainable use- use wisely -Habitat corridors -Connect pieces of land -Overcomes habitat fragmentation Reintroduction programs -put things back in their natural habitat Ex. condors Harmed by DDT(pesticide) Effect- thin eggs Captivity- under human control Problem with reintroduction programs: - Lose natural instinct PROTECT!! CONSERVE!! SAVE THE PLANET!!

59. 57 5 Unit 5 Review Characteristics of living organisms Cells/DNA reproduce grow/develop homeostasis adapt Steps of scientific Method problem hypothesis experiment data result conclusion R/R- repeat Theory: supported evidence Law: untestable fact Independent Variable: tested Dependent Variable: measured BioticLiving AbioticNot living HabitatWhere NicheJob EcologyStudy of… Levels of Ecology organism population community ecosystem biosphere Symbiosis: :/ 

60. Pyramid of energy (trophic levels) Energy: runs out AutotrophHeterotrophFood ChainFood Web Producer plant Consumer animal 5 th : Scavengers 4 th 3 rd het: carn eat carn 3 rd 2 nd het Carn eat herb 2 nd 1 st het Herb eat plant 1 st Autotroph Plant= producer

61. B D C AA: evaporation B: condensation C: precipitation D: transpiration CO2 increasesCO2 Decreases Breathe intrees pollution Energy runs outMatter is recycled Limiting Factor: prevents lifeTolerance: withstand change Nitrogen Fixation: fix N to make variable bacteria, plants PrimarySecondary newAfter disaster Forest fire Succession:

62. Aquatic: MarineFreshwater Saltwater/oceanLake/pond PhoticAphoticInterdependent Light shallow Deep No light Start of food chain, must be producer Island Theory 1. Small island has less BioDiv 2. Closer to equator, has more BioDiv tundra taiga Temp forest grassland Desert TRF

63. Tundra: permafrostTaiga: northern coniferous forest Grassland: crops, grazers Forest: seasonal deciduous Desert: hot and conserve H2O Rainforest: hot rainy most BioDiv Biodiversity: number of different types of species Extinct: 0Endangered: close to 0Threatened: rapid population drop Habitat Loss: remove Habitat Fragmentation: separate Habitat Degradation: pollute Exotic Species: invade

64. Global Warming: raises temp. CO2 traps heat Sustainable UseHabitat CorridorCaptivityReintroduction Use wiselyConnects separated land Under human control Help put back Conservation: LinearJ CurveS Curve Rate: constantRate: exponentialRate: exponential with leveling off Not populationUnlimited resources realistic

65. Rapid life history: think mosquito small lots of babies short lives little care Short life history: think elephant large few babies long lives more care Carrying Capacity: max # environment can support DemographyAge StructureEmigrationimmigration Human population# of people at each age group exitinto Competition up when: 1. Population up 2. Resources down