Presentation is loading. Please wait.

Presentation is loading. Please wait.

Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy.

Similar presentations


Presentation on theme: "Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy."— Presentation transcript:

1

2 Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy. My picture: My definition: Gel Electrophoresis Tool used to create a DNA fingerprint My picture: My definition:

3 This is a DNA fingerprint. This is NOT a DNA fingerprint.

4  A unique band pattern of DNA fragments.  Unique to every individual, unless you have an identical twin

5  Gel Electrophoresis: › a tool used to create a DNA fingerprint; separates pieces of DNA based on size  (the number of base pairs in each piece).

6  Steps in DNA Fingerprinting › Step 1: Restriction enzyme cleaves specific DNA sequence › Restriction enzyme: the enzymes that “cuts” the DNA between the nitrogen bases › Cleave: to Cut

7  Step 2: DNA loaded into a gel electrophoresis..  Step 3: Bands are created as electricity forces DNA fragments through the gel. Small pieces move further than larger pieces.

8 12 cut DNA with restriction enzymes fragments of DNA separate out based on size 3 Stain DNA › ethidium bromide binds to DNA › fluoresces under UV light

9  Uses for DNA Fingerprinting: › Violent Crimes – determines source of DNA left at a crime scene. › Paternity - used to determine the father of a child

10  Comparing DNA samples from different organisms to measure evolutionary relationships – + DNA  turtlesnakeratsquirrelfruitfly

11 A DNA sample was retrieved from a rape kit completed at the hospital. The police have 3 possible suspects. A DNA fingerprint has been done to narrow done the suspect pool. Who is the police’s MAIN Suspect?

12 1. Why are restriction enzymes important when making a DNA fingerprint? 2. What do the bands represent on a DNA fingerprint? 3. Using the fingerprint to the right who is a possible suspect for murder?

13 Recombinant DNA/ Genetic Engineering Technology that combines DNA from two different organisms. One practical application of this process is making human insulin for people with Diabetes. Glo fish were the first genetically engineered Pet in 1993! A gene called “green fluorescent protein” was extracted from jellyfish to create the first glo fish. Their goal was to develop a fish that could detect pollution by selectively fluorescing in the presence of environmental toxinspollution environmentaltoxins

14 Is the male in the fingerprint the father of the girl?

15 YES !

16  Artificial breeding or AKA artificial selection › creating new breeds of animals & new crop plants to improve our food › A process in which humans consciously select for or against particular features in organisms. For example, the human may allow only organisms with the desired feature to reproduce or may provide more resources to the organisms with the desired feature

17 Evolution of modern corn (right) from ancestral teosinte (left).

18  Creating Insulin (a protein hormone) for people with Diabetes

19  Genetic Engineering: Modifications of DNA; AKA Recombinant DNA › Transgenic Organism: an organism which contains foreign DNA A gene isolated from a species of jellyfish which causes fluorescence was introduced into marmoset embryos that allows them to build green fluorescent protein (GFP) in their tissues. Which glows green when exposed to blue light.

20  Process in creating Transgenic organism: › Step 1: Restriction enzymes cleave DNA sequence at desired gene (ex. Insulin

21  Step 2 : The same restriction enzyme is used to cleave the vector › Vector: The structure used to carry the foreign DNA bacterial plasmids commonly used. › Plasmid: Circular DNA found in bacteria

22  Step 3: Foreign DNA and Vector spliced together › Splice: Combine

23  Step 4: The recombinant DNA is inserted into the host (bacteria cell). Host cell will copy and produce the protein

24  Recombinant DNA: form of artificial DNA that is created by combining two different sources of DNA

25 grow bacteria harvest (purify) protein transformed bacteria plasmid gene from other organism + recombinant plasmid vector

26 TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACG ATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATG CTAGC  Gene produces protein in different organism or different individual aa “new” protein from organism ex: human insulin from bacteria human insulin gene in bacteria bacteriahuman insulin How can bacteria read human DNA?

27  Should we produce artificial proteins?  Allergic reactions (adding a peanut gene to a corn plant)  Environmental problems from creating transgenic organisms › (ex. Oil digesting bacteria)

28  GMO stands for Genetically Modified Organisms ccrops/animation.html

29

30 grow bacteria harvest (purify) protein transformed bacteria plasmid gene from other organism + recombinant plasmid vector

31  Defective genes are identified and replaced with a functioning gene from another individual  Uses: replace missing of defective genes, Ex. Treating cystic fibrosis and hemophilia

32  The Human Genome Project: is a collaborative effort among scientists from around the world to map the genes of a human. › Uses: determine whether individuals may carry genes for genetic conditions in the hopes to develop gene therapy or genetically based medicines

33 1. Foreign DNA is spliced into what type of organism? 2. What is a most common use of Recombinant DNA? 3. Tobacco plant displays a bioluminescence (glows) due to a protein found in fireflies which controls the fireflies luminescence. Which is the transgenic organism, Tobacco plant or the firefly? 4. What was the purpose of the Human Genome Project?

34  1. Place the lettered steps in the correct order.  2. What organism usually acts as the host cell in the process of genetic engineering?  3. What is a plasmid?  4. What do hydrogen bonds hold together in a DNA molecule? C. Restriction enzymes cleave DNA sequence at desired gene (ex. Insulin D. The same restriction enzyme is used to cleave the vector A. Foreign DNA and Vector spliced together B. The recombinant DNA is inserted into the host (bacteria cell).


Download ppt "Restriction enzymes Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy."

Similar presentations


Ads by Google