Genetic Engineering Biology Ch.15.

Genetic Engineering Biology Ch.15

Copyright Pearson Prentice Hall
Selective Breeding Selective breeding allows only those organisms with desired characteristics to produce the next generation. Nearly all domestic animals and most crop plants have been produced by selective breeding. Copyright Pearson Prentice Hall

Selective Breeding Humans use selective breeding to pass desired traits on to the next generation of organisms. Copyright Pearson Prentice Hall

Selective Breeding Hybridization the crossing of dissimilar individuals to bring together the best of both organisms. Hybrids, the individuals produced by such crosses, are often hardier than either of the parents. Copyright Pearson Prentice Hall

Selective Breeding Inbreeding the continued breeding of individuals with similar characteristics. Inbreeding helps to ensure that the characteristics that make each breed unique will be preserved. Serious genetic problems can result from excessive inbreeding. Copyright Pearson Prentice Hall

Increasing Variation Breeders increase the genetic variation in a population by inducing mutations. Mutations occur spontaneously, but breeders can increase the mutation rate by using radiation and chemicals. Breeders can often produce a few mutants with desirable characteristics that are not found in the original population. Copyright Pearson Prentice Hall

Increasing Variation Producing New Kinds of Bacteria Introducing mutations has allowed scientists to develop hundreds of useful bacterial strains, including bacteria that can clean up oil spills. Copyright Pearson Prentice Hall

Increasing Variation Producing New Kinds of Plants Mutations in some plant cells produce cells that have double or triple the normal number of chromosomes. This condition, known as polyploidy, produces new species of plants that are often larger and stronger than their diploid relatives. Polyploidy in animals is usually fatal. Copyright Pearson Prentice Hall

15-2 Recombination DNA Copyright Pearson Prentice Hall

The Tools of Molecular Biology
Scientists use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules. Copyright Pearson Prentice Hall

Scientists use different techniques to: extract DNA from cells cut DNA into smaller pieces identify the sequence of bases in a DNA molecule make unlimited copies of DNA Copyright Pearson Prentice Hall

In genetic engineering, biologists make changes in the DNA code of a living organism. Copyright Pearson Prentice Hall

DNA Extraction DNA can be extracted from most cells by a simple chemical procedure. The cells are opened and the DNA is separated from the other cell parts. Copyright Pearson Prentice Hall

Cutting DNA Most DNA molecules are too large to be analyzed, so biologists cut them into smaller fragments using restriction enzymes. Enzymes found in bacteria used to destroy phage DNA Copyright Pearson Prentice Hall

Each restriction enzyme cuts DNA at a specific sequence of nucleotides. Molecular biologists have developed different techniques that allow them to study and change DNA molecules. Restriction enzymes cut DNA at specific sequences. This drawing shows how restriction enzymes are used to edit DNA. The restriction enzyme EcoR I, for example, finds the sequence CTTAAG on DNA. Then, the enzyme cuts the molecule at each occurrence of CTTAAG. The cut ends are called sticky ends because they may “stick” to complementary base sequences by means of hydrogen bonds.

Separating DNA In gel electrophoresis, DNA fragments are placed at one end of a porous gel, and an electric voltage is applied to the gel. When the power is turned on, the negatively-charged DNA molecules move toward the positive end of the gel. BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003.

DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec Jeffreys

How does it work? 99.9% of your DNA is the same as everyone else’s.
The 0.1% that differs are a combination of: Gene differences (Differences in the genes themselves) Differences in “polymorphic regions” between the genes on the DNA.

How does it work? Certain points between the genes on the DNA have repeating base sequences. For example: ATTACGCGCGCGCGCGCGCTAGC These are called variable number tandem repeats (VNTRs for short)

How does it work? Everyone has VNTRs at the same place in their DNA, but they are different lengths for different people. For example: Person 1: ATTACGCGCGCGCGCGCGTAGC (7 repeats) Person 2: ATTACGCGCGCGCGTAGC (5 repeats)

Using the DNA Sequence These enzymes also make it possible to take a gene from one organism and attach it to the DNA of another organism. Such DNA molecules are sometimes called recombinant DNA. BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003. Copyright Pearson Prentice Hall

Using the DNA Sequence Making Copies Polymerase chain reaction (PCR) is a technique that allows biologists to make copies of genes. A biologist adds short pieces of DNA that are complementary to portions of the sequence. Copyright Pearson Prentice Hall

Using the DNA Sequence DNA is heated to separate its two strands, then cooled to allow the primers to bind to single-stranded DNA. DNA polymerase starts making copies of the region between the primers. Copyright Pearson Prentice Hall

Transforming Bacteria
During transformation, a cell takes in DNA from outside the cell. The external DNA becomes a component of the cell's DNA. Copyright Pearson Prentice Hall

Foreign DNA is first joined to a small, circular DNA molecule known as a plasmid. Plasmids are found naturally in some bacteria and have been very useful for DNA transfer. Copyright Pearson Prentice Hall

Plasmids Short, circular DNA molecules outside the chromosome
Carry genes that are beneficial but not essential Replicate independently of chromosome en.wikipedia.org/?title=Plasmid

The plasmid has a genetic marker—a gene that makes it possible to distinguish bacteria that carry the plasmid (and the foreign DNA) from those that don't. Copyright Pearson Prentice Hall

During transformation, a cell incorporates DNA from outside the cell into its own DNA. One way to use bacteria to produce human growth hormone is to insert a human gene into bacterial DNA. The new combination of genes is then returned to a bacterial cell. The bacterial cell containing the gene replicates over and over.

How do you know which cells have been transformed?

Transforming Plant Cells
How can you tell if a transformation experiment has been successful? If transformation is successful, the recombinant DNA is integrated into one of the chromosomes of the cell. Copyright Pearson Prentice Hall

In nature, a bacterium exists that produces tumors in plant cells. Researchers can inactivate the tumor-producing gene found in this bacterium and insert a piece of foreign DNA into the plasmid. The recombinant plasmid can then be used to infect plant cells. Copyright Pearson Prentice Hall

When their cell walls are removed, plant cells in culture will sometimes take up DNA on their own. DNA can also be injected directly into some cells. Cells transformed by either procedure can be cultured to produce adult plants. Copyright Pearson Prentice Hall

Transforming Animal Cells
Many egg cells are large enough that DNA can be directly injected into the nucleus. Enzymes may help to insert the foreign DNA into the chromosomes of the injected cell. DNA molecules used for transformation of animal and plant cells contain marker genes.

Transforming Animal Cells
Gene Therapy DNA molecules can be constructed with two ends that will sometimes recombine with specific sequences in the host chromosome. The host gene normally found between those two sequences may be lost or replaced with a new gene. Copyright Pearson Prentice Hall

Applications of Genetic Engineering

Transgenic Organisms An organism described as transgenic, contains genes from other species. Copyright Pearson Prentice Hall

Transgenic Organisms Genetic engineering has spurred the growth of biotechnology. Transgenic animals and plants The Human Genome Project The production of vaccines, cancer drugs, and pesticides Engineered bacteria that can clean up toxic wastes Cloning Organ replacement Copyright Pearson Prentice Hall

Transgenic Organisms Transgenic bacteria produce important substances useful for health and industry. Transgenic bacteria have been used to produce: insulin growth hormone clotting factor BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003. Copyright Pearson Prentice Hall

Transgenic Organisms Transgenic animals have been used to study genes and to improve the food supply. Mice have been produced with human genes that make their immune systems act similarly to those of humans. This allows scientists to study the effects of diseases on the human immune system. Copyright Pearson Prentice Hall

Transgenic Animals Nils Lonberg, director at Medarex, bred two genetically modified mice, creating a mouse with a humanized immune system. In response to disease-causing agents, these mice make human antibodies in their cells, some of which might be developed into drugs.

Transgenic Organisms Researchers are trying to produce transgenic chickens that will be resistant to the bacterial infections that can cause food poisoning. Copyright Pearson Prentice Hall

Transgenic Organisms Transgenic plants are now an important part of our food supply. Many of these plants contain a gene that produces a natural insecticide, so plants don’t have to be sprayed with pesticides. Copyright Pearson Prentice Hall

Transgenic Plants Bt Corn
Engineering resistant corn. Following the insertion of a gene from the bacteria Bacillus thuringiensis, corn becomes resistant to corn borer infection. This allows farmers to use fewer insecticides

“Golden rice” has been genetically modified to contain beta-carotene
This rice could help prevent vitamin A deficiency Figure 12.18B

Cloning Dolly and Bonnie A clone is a member of a population of genetically identical cells produced from a single cell. In 1997, Ian Wilmut cloned a sheep called Dolly. The adult sheep is Dolly, the first mammal cloned from an adult cell. The lamb is Dolly’s first offspring, called Bonnie. The fact that Dolly was cloned did not affect her ability to produce a live offspring. Photo Credit: PA News Copyright Pearson Prentice Hall

Cloning In early 1997, Dolly made headlines as the first clone of an adult mammal.

Cloning Researchers hope cloning will enable them to make copies of transgenic animals and help save endangered species. Copyright Pearson Prentice Hall

Cloning Studies suggest that cloned animals may suffer from a number of genetic defects and health problems. Abnormal gene expression “old” DNA Copyright Pearson Prentice Hall

DNA technology raises important ethical questions
Our new genetic knowledge will affect our lives in many ways The deciphering of the human genome, in particular, raises profound ethical issues Many scientists have counseled that we must use the information wisely Figure 12.21A-C

Could transgenics harm human health or the environment?
Genetic engineering involves some risks Possible ecological damage from pollen transfer between GM and wild crops Pollen from a transgenic variety of corn that contains a pesticide may stunt or kill monarch caterpillars Figure 12.20A, B

Genetic Engineering Biology Ch.15.

Similar presentations

Presentation on theme: "Genetic Engineering Biology Ch.15."— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

Genetic Engineering Biology Ch.15.

Similar presentations

Presentation on theme: "Genetic Engineering Biology Ch.15."— Presentation transcript:

Similar presentations

About project

Feedback