Download presentation
Presentation is loading. Please wait.
Published byAustin Bond Modified over 9 years ago
2
Identify the structures labeled I, II, III, IV and V
3
AUGCCUAUUGAUGGCCCAUAAGUU How would a change in the sequence of nucleotides in a DNA molecule affect the mRNA transcribed from the DNA molecule? Any change in the DNA would cause a change in the mRNA molecule
4
The diagram below shows a codon chart. A codon chart shows which codons code for which amino acids.
5
This chart shows the amino acids coded for by each of the 64 possible mRNA codons. To find which amino acid the codon CAA codes for, follow these steps. (1) Look on the left side of the chart to find the large row of codons that begin with C. (2) Move across this row until you get to the column of codons whose second base is A. (3) Move down this column until you get to the row of codons whose third base is A. The codon CAA codes for the amino acid glutamine.
6
Suppose a DNA mutation led to a change in a single mRNA codon. Now suppose this codon changed from GCC to GCG. By looking at the codon chart, you can see that both of these codons code for the amino acid alanine. So even though the DNA and mRNA have changed, there is no change in the protein!
7
Methionine (start) LeucineTheronineStop
8
AUG AAU AAC GUU GUC GUA GUG CAU CAC
9
Based on the information provided in the table, which plant species is most closely related to the endangered species? Support your answer. LEU GLY SER PRO UAUGGGUCCCCU
10
Take two sheets of copy paper and separately fold them like a “hamburger.” Mark both folds one inch from the outer edges. 1.2.
11
On one of the folded sheets, cut from the top and bottom edge to the marked spot on both sides 3. On the second folded sheet, start at one of the marked spots and cut the fold between the two marks. 4.
12
Take the cut sheet from step 3 and fold it like a burrito. Place the burrito through the other sheet and then open the burrito. Fold the bound pages in half to form an eight- page book 5.
17
Positions Available in the genetics industry. Hundreds of entry-level openings for tireless workers. No previous experience necessary. Must be able to transcribe code in a nuclear environment. The ability to work in close association with ribosomes is a must. Accuracy and Speed vital for this job in the field of translation. Applicants must demonstrate skills in transporting and positioning amino acids. Salary commensurate with experience. Executive Position available. Must be able to maintain genetic continuity through replication and control cellular activity by regulation of enzyme production. Limited number of openings. All benefits. Supervisor of production of proteins—all shifts. Must be able to follow exact directions from double-stranded template. Travel from nucleus to the cytoplasm is additional job benefit. Applicants for the first job, “Positions Available,” could qualify if they were?
18
Positions Available in the genetics industry. Hundreds of entry-level openings for tireless workers. No previous experience necessary. Must be able to transcribe code in a nuclear environment. The ability to work in close association with ribosomes is a must. Accuracy and Speed vital for this job in the field of translation. Applicants must demonstrate skills in transporting and positioning amino acids. Salary commensurate with experience. Executive Position available. Must be able to maintain genetic continuity through replication and control cellular activity by regulation of enzyme production. Limited number of openings. All benefits. Supervisor of production of proteins—all shifts. Must be able to follow exact directions from double-stranded template. Travel from nucleus to the cytoplasm is additional job benefit. Applicants for the second job, “Accuracy and Speed,” could qualify if they were
19
Positions Available in the genetics industry. Hundreds of entry-level openings for tireless workers. No previous experience necessary. Must be able to transcribe code in a nuclear environment. The ability to work in close association with ribosomes is a must. Accuracy and Speed vital for this job in the field of translation. Applicants must demonstrate skills in transporting and positioning amino acids. Salary commensurate with experience. Executive Position available. Must be able to maintain genetic continuity through replication and control cellular activity by regulation of enzyme production. Limited number of openings. All benefits. Supervisor of production of proteins—all shifts. Must be able to follow exact directions from double-stranded template. Travel from nucleus to the cytoplasm is additional job benefit. Applications for the third job, “Executive Position,” could qualify if they were
20
Positions Available in the genetics industry. Hundreds of entry-level openings for tireless workers. No previous experience necessary. Must be able to transcribe code in a nuclear environment. The ability to work in close association with ribosomes is a must. Accuracy and Speed vital for this job in the field of translation. Applicants must demonstrate skills in transporting and positioning amino acids. Salary commensurate with experience. Executive Position available. Must be able to maintain genetic continuity through replication and control cellular activity by regulation of enzyme production. Limited number of openings. All benefits. Supervisor of production of proteins—all shifts. Must be able to follow exact directions from double-stranded template. Travel from nucleus to the cytoplasm is additional job benefit. Applicants for the fourth job, “Supervisor,” could qualify if they were
Similar presentations
© 2025 SlidePlayer.com Inc.
All rights reserved.