2. 8.4 Transcription outsideProteins are made in the ribosomes outside the nucleus. DNA is copied (replicated) in the nucleus but cannot leave the nucleus. THEREFORE……. A message must be sent to the ribosomes in the cytoplasm telling them what proteins to make. This message is carried by a nucleic acid called messenger (mRNA ).

3. 8.4 Transcription RNA Structure 1.RNA is a single strand 2.RNA has the sugar ribose 3.Adenine bonds with Uracil (NOT thymine). 4.Can leave the nucleus RNA differs from DNA in 4 ways:

4. 8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

5. 8.4 Transcription RNA carries DNA’s instructions. The central dogma states that information flows in one direction from DNA to RNA to proteins.

6. 8.4 Transcription The central dogma includes three processes. 1. Replication 2. Transcription 3. Translation RNA is a link between DNA and proteins. replication transcription translation

7. 8.4 Transcription Transcription copies DNA to make a strand of RNA. DNA

8. 8.4 Transcription start site nucleotides transcription complex Transcription occurs in two major steps. 1.DNA unzips & unwinds at the start of a gene.

9. 8.4 Transcription DNA Transcription occurs in two major steps. 2.Nucleotides pair with their complementary bases on one strand of the DNA. –RNA polymerase bonds the nucleotides together. –The DNA helix winds again as the gene is transcribed. RNA polymerase moves along the DNA

10. 8.4 Transcription The RNA strand detaches from the DNA once the gene is transcribed. Then it leaves the nucleus and heads to a ribosome. RNA

11. 8.4 Transcription Transcription makes three types of RNA. 1.Messenger RNA (mRNA) - carries the message that will be translated to form a protein. 2.Ribosomal RNA (rRNA) - forms part of ribosomes where proteins are made. 3.Transfer RNA (tRNA) - brings amino acids from the cytoplasm to a ribosome.

12. 8.4 Transcription KEY CONCEPT Translation converts an mRNA message into a polypeptide, or protein.

13. 8.4 Transcription Amino acids are coded by mRNA base sequences. codon for methionine (Met) codon for leucine (Leu) Translation converts mRNA messages into polypeptides. A codon is a sequence of three nucleotides that codes for an amino acid.

14. 8.4 Transcription The language of amino acids is based on codons 1 codon = 3 mRNA nucleotides 1 codon =1 amino acid A U A U A U G C C C G C How many codons are in this sequence of mRNA? 4 How many Amino Acids does this gene code for? 4

15. 8.4 Transcription The genetic code matches each codon to its amino acid or function. three stop codons one start codon, codes for methionine

16. 13.1 Ecologists Study Relationships How to read a codon table Use in protein synthesis for translating the mRNA code into amino acid sequence

17. 8.4 Transcription You need a sequence of mRNA Where does this come from? From the transcription of DNA --> mRNA DNA sequence: TAC GGA CAT AAC ACC TGC ATC mRNA sequence: AUG CCU GUA UUG UGG ACG UAG Example:

18. 8.4 Transcription Transcription mRNA sequence leaves the nucleus and travels to the cytoplasm to a free floating ribosome or to the rough ER. It will attach to the ribosome and begin the second step of protein synthesis, translation.

19. 8.4 Transcription Translation mRNA is read as a series of codons (three letters) within the ribosome. tRNA molecules have an anticodon sequence of letters that are complements to the mRNA ex: mRNA CGA UCC (codon) tRNA GCU AGG (anticodon)

20. 8.4 Transcription So now we get to the codon table! Locate the first letter of your codon using the left side of the table. Ex. AUG look for the A

21. 8.4 Transcription Now move to the second letter of your codon which is ‘U’ Look at the top of the table where you see the title ‘2nd letter’ Find the letter ‘U’ and follow it down until it intersects with the letter ‘A’ from the left side. You should see four amino acids (isoleucine, isoleucine, isoleucine, and (start) methionine.

22. 8.4 Transcription Down to the last letter of the codon! Look to the right hand side for the third letter. Find the letter ‘G’ which will intersect with the box that had our four choices. Move your finger from the ‘G’ on the left over to the left and you should land on ….. Methionine (start) Yes you did it!!! Now try another codon

23. 8.4 Transcription Try the codon CAC Don’t peek until you come up with your answer! Did you get the amino acid ‘histidine’?

24. 8.4 Transcription Using this chart, you can determine which amino acid the codon “codes” for! Which amino acid is encoded in the codon CAC?

25. 8.4 Transcription Notice there is one start codon AUG. Transcription begins at that codon!

26. 8.4 Transcription Notice there are three stop codons. Transcription stops when these codons are encountered.

27. 8.4 Transcription What do these codons have to do with proteins? Each codon represents an amino acid that will eventually form a protein that is used within a cell. Proteins are made up of hundreds of amino acids in a specific sequence. When they get “out of order’ a mutation occurs. Long string of amino acids will form

28. 8.4 Transcription A change in the order in which codons are read changes the resulting protein. Regardless of the organism, codons code for the same amino acid.

29. 8.4 Transcription Amino acids are linked to become a protein. An anticodon is a set of three nucleotides that is complementary to an mRNA codon. An anticodon is carried by a tRNA.

30. 8.4 Transcription Ribosomes consist of two subunits. –The large subunit has three binding sites for tRNA. –The small subunit binds to mRNA.

31. 8.4 Transcription For translation to begin, tRNA binds to a start codon and signals the ribosome to assemble. –A complementary tRNA molecule binds to the exposed codon, bringing its amino acid close to the first amino acid.

32. 8.4 Transcription

33. The ribosome helps form a peptide bond between the amino acids.

34. 8.4 Transcription –The now empty tRNA molecule exits the ribosome. Once the stop codon is reached, the ribosome releases the protein and disassembles.

35. 8.4 Transcription aa mRNA From gene to protein DNA transcription nucleus cytoplasm protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome tRNA aa

36. 8.4 Transcription protein transcription cytoplasm nucleus translation trait

37. 8.4 Transcription From gene to protein transcription translation protein