Regents Biology Mutations Changes to DNA

Regents Biology Mutations  Changes to DNA are called mutations  change the DNA  changes the mRNA  may change protein  may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

Regents Biology Types of mutations  Changes to the letters (A,C,T,G bases) in the DNA  point mutation  change to ONE letter (base) in the DNA  may cause change to protein, may not  frameshift mutation  addition of a new letter (base) in the DNA sequence  deletion of a letter (base) in the DNA  both of these shift the DNA so it changes how the codons are read  big changes to protein!

Regents Biology Point Mutations  One base change  can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN THEFATCATENDTHEREDRATRAN OR Change letters

Regents Biology Point Mutations  Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop AUGCGUGUAUACGUAUGCGAGUGA Met Arg Val Tyr Val Cys Glu Stop

Regents Biology Sickle cell anemia  Hemoglobin protein in red blood cells  strikes 1 out of 400 African Americans  limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids

Regents Biology Point Mutations  Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop AUGCGUGUAUACGCUUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop

Regents Biology Point Mutations  Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop AUGCGUGUAUAAGCAUGCGAGUGA Met Arg Val Stop

Regents Biology Frameshift Mutations  Add or delete one or more bases  changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR Add letters Remove letters

Regents Biology Frameshift Mutations  Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop AUGCGUGUAUACGUCAUGCGAGUGA Met Arg Val Tyr Val Met Arg Val A

Regents Biology Frameshift Mutations  Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop AUGCGUGUAUACGAUGCGAGUGA Met Arg Val Tyr Asp Ala Ser GA

Regents Biology Cystic fibrosis  Broken salt channel in cells  strikes 1 in 2500 white births  gene codes for a protein channel that allows salt to flow across cell membrane  broken protein doesn’t work as channel  doesn’t allow salt out of cell, so water doesn’t flow out either  thicker & stickier mucus coating around cells  mucus build-ups in lungs & causes bacterial infections  destroys lung function  without treatment children die before 5; with treatment can live past their late 20s

Regents Biology Effect on Lungs Salt channel transports salt through protein channel out of cell Osmosis problems! airway salt H2OH2O H2OH2O normal lungs cystic fibrosis cells lining lungs salt channel normal mucus thick mucus mucus & bacteria build up = lung infections & damage 

Regents Biology Deletion leads to Cystic fibrosis deletion Loss of one amino acid!