Presentation is loading. Please wait.

Presentation is loading. Please wait.

Mutations Changes to DNA

Similar presentations


Presentation on theme: "Mutations Changes to DNA"— Presentation transcript:

1 Mutations Changes to DNA

2 Learner Outcomes I can explain how mutations may or may not impact the protein that is made in protein synthesis. I can identify and explain the different types of mutations.

3 Standards Addressed: Use mRNA codon charts to determine the effects of different types of mutations on amino acid sequence and protein structure (e.g., sickle cell anemia resulting from base substitution mutation) SC-HS SC-H-UD-S-3 SC-HS (DOK 3) Students will explain the role of DNA in protein synthesis. Cells store and use information to guide their functions. The genetic information stored in DNA directs the synthesis of the thousands of proteins that each cell requires. Errors that may occur during this process may result in mutations that may be harmful to the organism.

4 Mutations Changes to DNA are called mutations change the DNA
changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

5 Types of mutations Changes to the letters (A,C,T,G bases) in the DNA
point mutation change to ONE letter (base) in the DNA may cause change to protein, may not frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!

6 Does this change the sentence?
Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN

7 Does this change the protein?
Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop

8 Misshapen sickle cells
Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids

9 The code has repeats in it! Does this change the protein?
Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop The code has repeats in it! Does this change the protein? Why not? AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop

10 Really destroyed that protein!
Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyed that protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop

11 Does this change the sentence?
Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN

12 Does this change the protein?
Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA

13 Does this change the protein?
Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA

14 Cystic fibrosis Broken salt channel in cells
strikes 1 in 2500 white births gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function without treatment children die before 5; with treatment can live past their late 20s Cystic fibrosis is an inherited disease that is relatively common in the U.S. Cystic fibrosis affects multiple parts of the body including the pancreas, the sweat glands, and the lungs. When someone has cystic fibrosis, they often have lots of lung problems. The cause of their lung problems is directly related to basic problems with diffusion and osmosis in the large airways of the lungs. People without cystic fibrosis have a small layer of salt water in the large airways of their lungs. This layer of salt water is under the mucus layer which lines the airways. The mucus layer in the airways helps to clear dust and other inhaled particles from the lungs.

15 Deletion leads to Cystic fibrosis
Loss of one amino acid!


Download ppt "Mutations Changes to DNA"

Similar presentations


Ads by Google