Presentation is loading. Please wait.

Presentation is loading. Please wait.

Ch Mutations Section Objectives:

Published byBrice Shon George Modified over 6 years ago

Similar presentations

Presentation on theme: "Ch Mutations Section Objectives:"— Presentation transcript:

1 Ch. 12.4 Mutations Section Objectives:
Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations on cells and organisms.

2 Mutations Any change in DNA sequence is called a mutation. can be caused by errors in replication, transcription, cell division, or by external agents. If mutation occurs in gametes (sex cells) it will be passed on to offspring may produce a new trait or it may result in a protein that does not work correctly. the mutation results in a protein that is nonfunctional, and the embryo may not survive In some rare cases a gene mutation may have positive effects.

3 Mutations If mutation takes place in a body cell, it is not passed on to organism’s offspring Damage to a gene may impair the function of the cell When that cell divides, the new cells also will have the same mutation Some mutations of DNA in body cells affect genes that control cell division. This can result in the cells growing and dividing rapidly, producing cancer.

4 Mutations Changes to DNA are called mutations change the DNA
changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

5 Types of mutations Changes to the letters (A,C,T,G bases) in the DNA
point mutation change to ONE letter (base) in the DNA may cause change to protein, may not frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!

6 Does this change the sentence?
Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN

7 Does this change the protein?
Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop

8 Misshapen sickle cells
Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids

9 The code has repeats in it! Does this change the protein?
Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop The code has repeats in it! Does this change the protein? Why not? AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop

10 Really destroyed that protein!
Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyed that protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop

11 Does this change the sentence?
Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN

12 Does this change the protein?
Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA

13 Does this change the protein?
Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA

14 Causes of Mutations sometimes a mistake in base pairing during DNA replication. many mutations are caused by factors in the environment Any agent that can cause a change in DNA is called a mutagen. Mutagens include radiation, chemicals, and even high temperatures

Download ppt "Ch Mutations Section Objectives:"

Similar presentations

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)
CHAPTER 14: Genes in Action

CHAPTER 14: Genes in Action
1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.

1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.
MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.
Section 11.3 MUTATIONS Section 11.3 pgs. 296 - 301.

Section 11.3 MUTATIONS Section 11.3 pgs
Mutations Changes to DNA

Mutations Changes to DNA
Mutations Changes to DNA

Mutations Changes to DNA
Ch Mutations Section Objectives:

Ch Mutations Section Objectives:
Review: DNA, Transcription & Translation

Review: DNA, Transcription & Translation
Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,

Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,
DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.

DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.
Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?
BIOLOGY HONORS MUTATIONS. WHAT IS A MUTATION? A change in DNA Can cause changes in organism Happen randomly Can be beneficial, neutral, or harmful For.

BIOLOGY HONORS MUTATIONS. WHAT IS A MUTATION? A change in DNA Can cause changes in organism Happen randomly Can be beneficial, neutral, or harmful For.
Regents Biology 2009-2010 Mutations Changes to DNA.

Regents Biology Mutations Changes to DNA.
Ch. 12.4 Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.

Ch Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.
Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.
Regents Biology 2009-2010 Mutations Changes to DNA.

Regents Biology Mutations Changes to DNA.
2009-2010 Mutations Changes to DNA Mutations Changes to DNA are called mutations – change the DNA – changes the mRNA – may change protein – may change.

Mutations Changes to DNA Mutations Changes to DNA are called mutations – change the DNA – changes the mRNA – may change protein – may change.
1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.

1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.
DNA/RNA Transcription and Translation Review… DNA is responsible for controlling the production of proteins in the cell, which is essential to life –DNA.

DNA/RNA Transcription and Translation Review… DNA is responsible for controlling the production of proteins in the cell, which is essential to life –DNA.

Similar presentations

Ads by Google