Happy Monday! Bellwork: October 26 Write the following question and your answers on a bellwork page. In what organelle does transcription occur in the.

Slides:



Advertisements
Similar presentations
Protein Targetting Prokaryotes vs. Eukaryotes Mutations
Advertisements

Bellwork: Using the codon charts in your notes, fill in the boxes below. **Remember to use mRNA when doing translation**
HAPPY TUESDAY Bellwork: Study the Central Dogma, Transcription, & Translation. On Bellwork sheet write “Study for Quiz”.
DNA Mutations Biology 6(E).
DNA MUTATIONS.
Section 11.3 MUTATIONS Section 11.3 pgs
Mutations Mutation- a change in the DNA nucleotide sequence
MUTATIONS Section 11.3 pgs
12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.
Section 11.3 MUTATIONS Section 11.3 pgs
Mutations Foldable Fold 3 pieces of paper, so you have 5 layered flaps
Mutations. DNA Mistakes DNA is a molecule that replicates, works and copies with very high accuracy DNA has enzymes that make sure that it works with.
Happy Tuesday! Bellwork: October 28 Write the following question and your answers on a bellwork page. In what organelle does transcription occur in the.
Ch Mutations Section Objectives:
Chapter 14 Homework is due on Sunday, January 25 at 11:59 pm The Chapter 13 and 14 test is on Monday.
BELL WORK: You have five minutes to finish yesterday’s worksheets and turn them in.
Point Mutations Silent Missense Nonsense Frameshift.
Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.
Bell Work tRNA’s anticodons are complementary to mRNA’s codons when they meet in the ribosome, why is it important that they are the exact complement?
 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.
Mistakes in the code. Review: What does DNA look like? How is DNA made? How does DNA instruct the cell to make proteins? What determines the order of.
Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology.
Section 11.3 MUTATIONS Section 11.3 pgs
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
Ch. 9.7 Mutations Every once in a while, cells make mistakes in copying their own DNA An incorrect base can be inserted or sometimes a base is skipped.
Bellwork: ***STUDY FOR VOCAB 4 QUIZ*** Using the codon charts in your notes, fill in the boxes below. **Remember to use mRNA when doing translation**
 BUILD-A-BUG ACTIVITY  Build your bug and turn in to your box  Mutations Notes  Mutations practice QUIZ NEXT CLASS: Transcription and Translation TUESDAY.
Mistakes in the code. Review: What does DNA look like? How is DNA for a new cell made? How does DNA instruct the cell to make proteins? What determines.
Gene: TTCGATCGC 1.Replicate 2.Transcribe 3.Translate 5/16/16 Date:5/16/16Topic:MutationsPage # ___ What sequences of amino acids do you end up with? Pass.
Mutations.
“How does it affect the protein?”
Gene Mutations.
Mutations.
A B C HAVE NOTECARDS OUT IN A STACK Transcription Replication
When things go wrong in the DNA!
Mutations.
aspartate / aspartic acid
DNA MUTATIONS.
What sequences of amino acids do you end up with?
Mutations.
Mutations.
Set up Page 34 for Cornell Notes
Types of Mutations.
Gene Mutations Chapter 11.
I need these old homework assignments from these students
Gene Mutations.
MUTATIONS.
Genetic Mutations.
Mutations.
Mutations.
Types of point mutations
To be successful today…
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
Mutations changes in the DNA sequence that can be inherited
Materials: 2 worksheets
Homework: Study for midterm tomorrow
Entry Task Apply: Suppose a template strand of DNA had the following sequence: DNA: T A C G G A T A A C T A C C G G G T A T T C A A What would.
Entry Task Apply: Suppose a template strand of DNA had the following wild-type gene sequence: DNA: T A C G G A T A A C T A C C G G G T A T T C.
Mutations (Section 17-5) Now, that you know how gene expression works, let’s see how changes in the gene affect how the protein is made.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
DNA MUTATIONS A mutation is a change in the DNA code.
Mutations.
Mutations Changes in the DNA code.
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Draw a conclusion from this graph for both the red and blue line
MUTATIONS.
Mutation Notes.
Mutations.
Presentation transcript:

Happy Monday! Bellwork: October 26 Write the following question and your answers on a bellwork page. In what organelle does transcription occur in the cell? In what organelle does translation occur?

Science Fact of the Day: Fingernails grow four times as fast as toenails.

Let’s get ready! Title: DNA Mutations Date: Essential Question: What effect will a mutation have on the body? Fold your mutation paper in half hot dog style and glue it in on the left side of the page. Leave some room at the bottom

Think about it: What happens if our DNA gets messed up?

Do you know of any diseases caused by genetic mutations?

Mutations: changes in the genetic material caused by mistakes during replication, transcription, or due to environmental factors (radiation) Sickle Cell Anemia Color Blindness Crystal clear underwater vision! Crystal clear underwater vision Resistance to HIV

In other words mutations are changes in DNA How big is DNA? How big is DNA?

Two major types of mutations: Point Mutations (substitutions) A mutation that changes a single base Frameshift Mutations An insetion or deletion that affects the entire amino acid sequence

Normal DNA Phe Tyr AlaArg DNA mRNA

Silent: DNA mRNA PheTyr Ala Arg Even though a base changes, it does not cause a change in the amino acids Point Mutation Mutations only “matter” if they change the amino acid sequence. Ex. Wicked Bible

Missense: DNA mRNA PheTyr Gly Arg A base change causes a change in one amino acid Point Mutation

Nonsense: DNA mRNA PheStop Ala Arg A base change causes an early stop Point Mutation

Insertion: DNA mRNA Phe IsoCysThr A base is added and causes a change in all the amino acids after it Frameshift Mutation

Deletion: DNA mRNA Phe LeuHis A base is deleted and causes a change in all the amino acids after it Frameshift Mutation

Genetic Mutations: Your Name 1.Copy the chart below. 2.Write your name in the first box. 3.Put a box around each codon. 4.Fill in the rest of the start by doing the mutation. 5.Put a box around each codon after the mutation. Name:T I F F A N Y J O Y J O N E S Insertion (add a base into the sequence) T I F F A N Y Z J O Y J O N E S Deletion (take a base away) T I F F A N J O Y J O N E S Substitution (take out a base and put a different one in its place T I F F A N Z J O Y J O N E S

Quick Write Which is more likely to have a bigger effect on an organism, a point mutation or frameshift mutation? Explain why.

Use the remainder of class to start on your homework (due tomorrow). The amino acids can be abbreviated to only the first 3 letters.

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2024 SlidePlayer.com Inc. All rights reserved.