Homeobox leucine zipper protein 9 (HAT9) -AT2G22800 -Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ 1400 -Helix-turn-helix 5’3’ FWRV.

Slides:



Advertisements
Similar presentations
T-DNA Mutagenesis T-DNA Mutagenesis. Transfer-DNA Mutagenesis: a chemical or physical treatment that creates changes in DNA sequence which can lead to.
Advertisements

Arabidopsis thealiana AT3G56230 AT4G18650 What are the functions of them? Are they important for seed development? Spring 2004 Mariko Onozawa.
Determining the roles of the BTB genes At2g04740, At4g08455, At1g04390, and At2g30600 in Arabidopsis thaliana growth and development. Brandon D. Blaisdell,
The Trihelix Transcription Factor Family Heather Hernandez.
Suppl Figure S1. mMDH genes in At and t-DNA mutant characterization. A) MDHs in Arabidopsis B) T-DNA insertions available At1g53240 mMDH1 At3g15020 mMDH2.
Cloning Promoters Kelli Henry April 27, 2009.
HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana
Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.
What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.
At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.
HC70AL Spring 2009 An Introduction to Bioinformatics By Brandon Le & Min Chen April 7, 2009.
What Are the Methods and Approaches Used Study Knock-Out Mutations? Elaine Chiu Nancy Phang June 4, 2009.
The MYB and BHLH Transcription Factor Families by Elaine Chiu.
The Maize ropD Gene Christine Neou Dr. John Fowler Botany and Plant Pathology.
Mutations in Arabidopsis Exocyst Gene AtSEC8 Jennie Hines Mentor: John Fowler.
Arabidopsis Experiments
A Hypothesis for the function of gene AT4G23180 in A. thaliana By Nicole Foxworth and Deborah Lee (Ether Fowl Ox)
Supplemental Figure 1 Chlorophyll fluorescence (rel) 1 min pgr5 pgr5 + NEM (0.5mM) Supplemental Figure 1: In vivo detection of the NDH-dependent electron.
F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.
HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.
Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.
The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.
Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.
Fig. S1. Amino acid sequence alignment of MYBS3 proteins. MYBS3 protein sequences of Arabidopsis thaliana (MYBH; NP_199550); (At3g16350; NP_188256), Glycine.
AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p.
The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.
Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.
A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.
THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family
Daisy Robinton Matt Emmer Jason Chai
The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.
The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.
Genetics & Genotyping By Kristin Gill & Daisy Robinton HC70AL Spring 2009.
Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.
Searching for Genes Important in Seed Development At1g19000 At1g74840 BY: Mike Douglas.
WT#3#5#7#9#11#14#15#20#25#30 35S::JAZ13 Root length ratio * * * * * * * * * * Figure S2. Overexpression of native (untagged)
Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.
Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.
NAC Family Genes AT1G01720 AT1G77450
Supplemental Fig. S1 A B AtMYBS aa AtMYBS
Searching for the Genes that Control Seed Development
a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c
Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?
Potassium Transporter KUP7 Is Involved in K+ Acquisition and Translocation in Arabidopsis Root under K+-Limited Conditions  Min Han, Wei Wu, Wei-Hua Wu,
Emily Eder HC70AL - Spring 2005
Tandem Inserts, Phenotypic Segregation, Hypocotyl Length, and More…
Phylgenetic tree.
Recurrent inversion breaking intron 1 of the factor VIII gene is a frequent cause of severe hemophilia A by Richard D. Bagnall, Naushin Waseem, Peter M.
Is AT2G23290 Important in Seed Development?
Welcome to the world of two Arabidopsis genes:
The Alfin-like PHD Zinc Finger Transcription Factor Family
Does Gene AT5G19490 Play a vital role in seed development?
HC70AL Final Presentation
Put Your Dukes Up AT5G03220! Studying Embryo Lethality of
HC70AL Oral Presentation
What is AT5G03500? --Background and Structure--
Volume 28, Issue 3, Pages (November 2007)
At2G37120: A Gene Exploration
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
HC70AL Research Presentation
Xiaofeng Cao, Steven E. Jacobsen  Current Biology 
Potassium Transporter KUP7 Is Involved in K+ Acquisition and Translocation in Arabidopsis Root under K+-Limited Conditions  Min Han, Wei Wu, Wei-Hua Wu,
Heat Shock Factor Protein Family of Transcription Factors
Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2
Quick genetics review.
Arabidopsis Thaliana Gene AT5G58610
Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
BRI1/BAK1, a Receptor Kinase Pair Mediating Brassinosteroid Signaling
Volume 7, Issue 8, Pages (August 2014)
Presentation transcript:

Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV Exon 1 UTR Exon 3Exon 2 Intron 1Intron ’3’ Research Talk HC70AL Spring 2004 by Bobby Fam

Evolutionary Relationships of HAT Proteins -Alignment of HAT9 and HAT22 reveals 90% identity in the homeodomain-leucine zipper region and 71% identity overall. -Little homology is seen outside of the homeodomain- leucine zipper region for other proteins.

Gene Activity of AT2G kb kb Leaf: 1,2 Stem: 3,4 Flower: 5,6 Ovule: 7,8 Embryo: 9,10 Axis: 11,12 Leaf: 13,14 Flower: 15,16 -Gene specific bands for leaf, stem, flower, unfertilized ovules, and 30 DAP axis. -Arabidopsis: Activity in WT mature green seeds, WT Post- Maturation Green Seeds, and WT Roots -Possible Alternative Splicing 14 DAP embryo (lane 9).

Madison Screen Round Control 1600 bp 1800 bp 4500 bp Round C 1kb -T-DNA insert in either superpool 10 or 22 -Sequencing data matches HAT9 but has no T-DNA -Reamplification yielded no matching bands

SALK T-DNA Insertion Gene: AT5G67300SALK Line: WT H 2 0 1kb1kb WT H 2 0 FW/RV Gene-specific RV Gene-specifc & LBb1 primer -Plant 5 represents a homozygous T- DNA genotype -Plants 1,2,3,4,6,7,8, & 9 represent

Phenotyping SALK Insert Plant Mutant FlowerWT leaf on left; Mutant leaf on right WT Silique top; Mutant Silique bottom Mutant Trichome -Mutant plant does not seem to differ in phenotype from the Wild-type in any significant manner

To the Future… -Sequence Madison Inserts -Identify DNA Pool (Reorder) -Identify Seed Pool -Identify Knock-out Line -Grow Plants & Observe AT2G22800 AT5G Investigate other knockout lines -Study other genes and their effects on seed development -Determine specific role of genes on seed development -Engineer the 21st Century Crop