Chapter 17 Transcription and Translation From Gene to Protein.

Slides:



Advertisements
Similar presentations
Chapter 17~ From Gene to Protein
Advertisements

Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.
 Assemble the DNA  Follow base pair rules  Blue—Guanine  Red—Cytosine  Purple—Thymine  Green--Adenine.
Transcription & Translation
PROTEIN SYNTHESIS.
RNA (Ribonucleic acid)
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.
FROM DNA TO PROTEIN Transcription – Translation We will use:
Protein Synthesis Transcription and Translation. The Central Dogma The information encoded with the DNA nucleotide sequence of a double helix is transferred.
Chapter 17~ From Gene to Protein.
VII RNA and Protein Synthesis
From Gene to Protein Chapter 17.
What is the job of p53? What does a cell need to build p53? Or any other protein?
Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.
Chapter 17 Central Dogma of Molecular Biology From Genes to Protein One gene – one polypeptide hypothesis One gene dictates the production of a single.
 The replication of DNA takes place in S phase of interphase  However, DNA is also used during G 1 to assemble proteins  This process is broken down.
Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.
Protein Synthesis Process that makes proteins
Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.
12-3 RNA and Protein Synthesis
Peptide Bond Formation Walk the Dogma RECALL: The 4 types of organic molecules… CARBOHYDRATES LIPIDS PROTEINS (amino acid chains) NUCLEIC ACIDS (DNA.
Transcription vs Translation. Central Dogma Transcription Translation.
Genes and How They Work Chapter The Nature of Genes information flows in one direction: DNA (gene)RNAprotein TranscriptionTranslation.
Biology 102 Gene Regulation and Expression Part 2.
Copyright © 2006 Pearson Prentice Hall, Inc. Chapter 9 Gene Expression and Regulation.
Ch 12-3 Notes, part 2 The Central Dogma = Protein Synthesis.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
N Chapter 17~ From Gene to Protein. Protein Synthesis: overview n One gene-one enzyme hypothesis (Beadle and Tatum) –The function of a gene is to dictate.
Gene Activity Chapter 14. Gene Activity 2Outline Function of Genes  One Gene-One Enzyme Hypothesis Genetic Code Transcription  Processing Messenger.
1. Transcription and Translation 2copyright cmassengale.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
Chapter 17 From Gene to Protein.
1 RNA ( Ribonucleic acid ) Structure: Similar to that of DNA except: 1- it is single stranded polyunucleotide chain. 2- Sugar is ribose 3- Uracil is instead.
Chapter – 10 Part II Molecular Biology of the Gene - Genetic Transcription and Translation.
FROM DNA TO PROTEIN Transcription – Translation
Lecture 15 From Gene to Protein.
Protein synthesis DNA is the genetic code for all life. DNA literally holds the instructions that make all life possible. Even so, DNA does not directly.
Protein Synthesis (Transcription and Translation)
What is Transcription? Transcription is the transfer of genetic information from DNA into messengerRNA (mRNA). It occurs in the nucleus of the cell.
Transcription Translation
From Genes to Protein Chapter 17.
PROTEIN SYNTHESIS CHAPTER 10 section 4
Types of RNA and TRANSCRIPTION
Enzymes and their functions involved in DNA replication
RNA and Protein Synthesis
RNA and Protein Synthesis
Protein Synthesis.
Protein Synthesis in Detail
Transcription and Translation
Chapter 14~ From Gene to Protein
Transcription & Translation.
Gene Expression: From Gene to Protein
Chapter 17 – From Gene to Protein
12-3 RNA and Protein Synthesis
RNA and Protein Synthesis
PROTEIN SYNTHESIS.
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Transcription Steps to Transcribe DNA:
(Transcription & Translation)
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
Translation.
Biology, 9th ed,Sylvia Mader
RNA and Protein Synthesis
GENE EXPRESSION / PROTEIN SYNTHESIS
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
copyright cmassengale
Lecture #7 Date _________
Protein Synthesis.
Protein Synthesis.
Presentation transcript:

Chapter 17 Transcription and Translation From Gene to Protein

Overview The “recipe” for a protein is encoded within the DNA One gene, one protein Recipe for one protein is copied into a working version in the form of RNA (Transcription) Recipe in RNA is used to make a protein (Translation)

Two Steps Required for Gene Expression Transcription Polymerization of RNA molecule from DNA template strand One gene one transcript Translation Production of a protein molecule based on the instructions contained within a mRNA molecule

Transcription Components Promotor TATA box RNA Polymerase RNA nucleotides Termination sequence

Steps in Transcription Initiation Elongation Termination

Transcription Initiation Transcription factors bind to TATA box RNA Polymerase joins transcription factors DNA strands opened RNA nucleotides aligned

Transcription Elongation Initiation factors remain at promotor RNA Polymerase catalyzes building of RNA molecule 5’-3’ direction of formation of RNA Continues until termination signal is reached

Transcription Termination RNA Polymerase reaches the termination signal Snap back Rho Complex destabilization Release of all components DNA closes

Movies of Transcription Transcription

Post Transcriptional Modification Eukaryotes only 3’ end- poly A tail 5’ end methylated guanine cap Exons Introns Splicing Splicosome Mature mRNA

Post transcriptional Modifications Splicing

Types of RNA r RNA - Pol I m RNA – Pol II t RNA – Pol III

Translation Manufacture of protein from information in mRNA

Components Involved in Translation Messenger RNA Ribosome A slot P slot E slot Transfer RNA Amino acids

Terms Codon Anticodon Gene Chromosome Genome

Steps found in Translation Initiation Elongation Termination

Initiation of Translation 5’ end of mRNA Start codon AUG Small sub unit of the ribosome Initiation tRNA Methionine Large sub unit of ribosome A slot P slot E slot

Elongation of Translation New A.A. bearing tRNA enters the A slot A.A. transferred from P slot onto AA in A slot Ribosome slides over one codon Continues until a stop codon enters the A slot

Termination of Translation Stop codon enters the A slot No tRNA H bonds to stop codon Release factor enters A slot Peptide chain hydrolysed from the tRNA in the P slot

Movie of Translation Translation Musical version

Recap

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2024 SlidePlayer.com Inc. All rights reserved.