Fig.1.8 DNA STRUCTURE 5’ 3’ Antiparallel DNA strands Hydrogen bonds between bases DOUBLE HELIX 5’ 3’

- sequence of DNA essential for specific function - codes for protein or structural RNA UTRs - untranslated regions which flank the coding sequence in a mRNA (so in transcribed region) “structural” gene ATG TAA 5’ 3’ 5’ Gene + flanking regulatory sequences 5’ 3’ DNA RNA AUG UAA Where is transcription initiation site? Transcription & RNA processing Where is translation initiation site? promoter? HOW TO DEFINE A GENE? (there are many descriptions...)

5’ 3’ 5’ Intron - non-coding sequences removed from pre-RNA (by splicing) Exon - sequences that remain in mature RNA (mostly coding) Eukaryotic (but not prokaryotic) genes usually contain introns ATGTAA mRNA “Exon 1”Exon 2 Intron 1 Intron 2 “Exon 3” DNA 5’ 3’ 5’ UTR 3’ UTR coding region Exon 1 Exon 2 Exon 3 Nomenclature “problem”: Textbooks (& papers) often show only coding sequences as exons, but first exon includes 5’UTR and last exon includes 3’UTR Dilemma because often the positions of RNA ends are not known or tissue-specific differences Introns can also occur within UTR regions

Mercer Nat Rev Genet 10: 155, 2009 Example of human pax6 gene Lines: introns Bars: exons Where would the initiation and stop codons be? What does the bent arrow signify? Tall bars: coding exons Short bars: non-coding exons

1. Human genes: Intron length: typically ~200 nt to > 10 kb Number per gene: several to dozens… Tennyson, Klamut & Worton (1995) “The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced” Nat Genet.9: Extreme example: < 5% have introns - mostly in tRNA genes (intron length ~ nt) (vs. mammals where >95% genes have introns) dystrophin gene (~2400 kb) with ~78 introns!! Exon length: typically nt 3. Yeast genes: …and in ribosomal protein genes (intron length ~ nt) Genes-within-genes! Other genes are sometimes located within long introns! … in same or opposite orientation (see Practice set #1, question 4) 2. Plant genes: Intron density similar to animals, but shorter length: typically nt

Golovnina et al. BMC Evol Biol 2005 Structure of NF2 (neurofibromatosis type II) gene in various animals What features of this gene are different among these animals?

5’ … gatcgctctataggaggtgc ATGCAATGG…3’5’…ATAGGACAT 3’…TATCCTGTA ctagcgagatatcctccacg TACGTTACC…5’ What are N-terminal sequences of proteins encoded by genes 1 and 2? But neighbouring operons might be in opposite orientation in genome Gene 2 Gene 1 Gene A Gene B Gene C - polycistronic mRNA, but each gene has its own start and stop codons Aside: My examples will often show unrealistically short sequences See also Practice question #2 Bacterial genes are often organized in operons with short intergenic spacers

Adachi & Lieber Cell 109: 807, 2002 bidirectional promoter ? Presence of genes located close together but encoded on opposite strands is sometimes also seen in eukaryotic genomes Where would promoter(s) for genes 1 and 2 be located? Gene 2 Gene 1

RNA structure Alberts Fig.6.4 RNA synthesized in 5’ to 3’ direction with antiparallel DNA strand as template 5’ 3’ Fig.1.11 Features of RNA vs. DNA RNA synthesis Template strand 5’ 3’ “Coding strand” mRNA has same sequence as coding strand (except U instead of T)

Fig.1.12 RNA content of a cell snRNAs (small nuclear) - role in splicing snoRNA (small nucleolar) - role in methylation of rRNAs miRNA (microRNAs) & siRNA (short interfering RNAs) - role in regulation of expression of individual genes small regulatory RNAs small non-coding (nc) regulatory RNAs are also present in bacteria sRNAs

Fig.1.13 RNA processing in eukaryotes - presence of long introns (& short exons) can make finding genes in eukaryotic DNA sequences difficult - may be alternative splicing pathways so more than one protein generated from one gene (Discussed later, Chapter 6)

- can deduce amino acid sequence of protein from nt coding sequence … using genetic code table “standard code” Link between transcriptome & proteome Genetic code Mediated by tRNAs (codon-anticodon) Fig.1.20 Fig.1.2 See Practice question #1

- in research papers DNA usually shown as single-stranded with coding strand in 5’ to 3’ orientation (left to right) PROTEIN-CODING GENES 5’ …. AUG GGA UUG CCC GCC …. 3’ 3’.… TAC CCT AAC GGG CGG …. 5’ 5’ …. ATG GGA TTG CCC GCC …. 3’ “coding strand” DNA “template strand” mRNA … so genetic code table can be used directly divided into triplets (codons)

Alberts Fig Amino acid one-letter abbreviation often used instead of 3-letters Translation termination codons Initiation codon Remember that although AUG is the standard initiation codon, there can also be AUG triplets within an ORF, … specifying internal Met residues in the protein And when analyzing DNA data obtained in the lab, initiation codon might be located outside the sequenced region

Examples of deviation from the standard genetic code in mitochondria and microbes Table 1.3

PROTEIN SEQUENCE & STRUCTURE Different proteins can be generated from single precursor polypeptide Fig through post-translational events …so can have larger proteome (set of proteins) than predicted from number of genes in genome Fig.1.17

Latin word “cis” means "on the same side as” 5’ 3’ Trans-acting factor: protein (or RNA) that binds to cis-element to control gene expression Cis-acting element: DNA (or RNA) sequences near a gene, that are important for its expression 3’ 5’ ATG TAA Cis-elements can actually be quite far away from genes they control in intergenic spacers (ENCODE project) and within introns DNA