The Genetic Code.

Slides:



Advertisements
Similar presentations
12-3 RNA and Protein Synthesis
Advertisements

RNA and Protein Synthesis
1 Review How does a cell interpret the genetic code Explain What are codons and anticodons 2 Review What happens during translation Compare and Contrast.
Translation Proteins are made by joining amino acids into long chains called polypeptides (proteins). Each polypeptide contains a combination of any or.
RNA and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
RNA and Protein Synthesis
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
RNA Transcription.
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
Protein and Translation. Central Dogma of Biology _____________________________________: -Transcription: The decoding of DNA into mRNA -Translation: The.
Protein Synthesis Chapter 11.
RNA & Protein Synthesis Intro Genes code DNA instructions that control the production of proteins within the cell. Genes The first step in decoding.
Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
RNA and Protein Synthesis
RNA and Protein Synthesis
RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.
VII RNA and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
Chapter 13: RNA and Protein Synthesis
Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Section 12-3 RNA & Protein Synthesis
Copyright Pearson Prentice Hall
RNA & Protein Synthesis
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
RNA & Protein Synthesis Continued: Translation. Translation: mRNA Protein Translation is taking mRNA and making proteins Sequence of nucleotide bases.
RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
End Show 12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 106. What are genes? They are coded.
Notes: Transcription DNA vs. RNA
RNA and Protein Synthesis
CH 12.3 RNA & Protein Synthesis.
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
Copyright Pearson Prentice Hall
12-3 RNA and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
Bellwork: How does a cell interpret the genetic code
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
Copyright Pearson Prentice Hall
RNA & Protein synthesis
12-3 RNA and Protein Synthesis
Comparing RNA and DNA Each nucleotide in both DNA and RNA is made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base. There are three important.
GENE EXPRESSION / PROTEIN SYNTHESIS
Amino acids are coded by mRNA base sequences.
13.2 Ribosomes and Protein Synthesis
Protein Synthesis.
13.2 Ribosomes and Protein Synthesis
13.2 Ribosomes and Protein Synthesis
4a. Know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA.
TRANSLATION and MUTATIONS
Presentation transcript:

The Genetic Code

The genetic code is the “language” of mRNA instructions. The code is written using four “letters” (the bases: A, U, C, and G). A _________ consists of three consecutive nucleotides on mRNA that specify a particular amino acid. codon

Each codon specifies a __________ amino acid that is to be placed on the polypeptide chain. Some amino acids can be specified by more than _________ codon. particular one

There is one codon _______that can either specify the amino acid methionine or serve as a “start” codon for protein synthesis. AUG There are ________ “stop” codons that do not code for any amino acid. These “stop” codons signify the end of a polypeptide. three

Translation is the __________ of an mRNA message into a polypeptide chain (protein). decoding Translation takes place on ribosomes. During translation, the cell uses information from messenger RNA to produce proteins.

Messenger RNA is ______________ in the nucleus, and then enters the cytoplasm where it ______________ to a ribosome. transcribed attaches Translation begins when an mRNA molecule attaches to a ____________. ribosome

As each codon of the mRNA molecule moves through the_____________, the proper amino acid is brought into the ribosome by tRNA. ribosome

In the ribosome, the ___________ is transferred to the growing polypeptide chain. Amino acid Each tRNA molecule ____________ only one kind of amino acid. In addition to an amino acid, each tRNA molecule has ______ unpaired bases. carries three

These bases, called the ___________, are complementary to one mRNA codon. The ribosome binds new tRNA molecules and amino acids as it moves along the mRNA. anticodon The process __________ until the ribosome reaches a stop codon. continues

The Roles of RNA and DNA The cell uses the DNA “master plan” to prepare RNA “_________.” The DNA stays in the ___________. blueprint nucleus protein The RNA molecules go to the ______ building sites in the cytoplasm—the ribosomes.

Genes and Proteins Genes contain instructions for assembling________. Many proteins are enzymes, which catalyze and _________ chemical reactions. proteins regulate

component template protein Proteins are each specifically designed to build or operate a _____________ of a living cell. The sequence of bases in DNA is used as a ______________ for mRNA. component template The codons of mRNA specify the sequence of amino acids in a __________________. protein

Do Questions 8-22

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2024 SlidePlayer.com Inc. All rights reserved.