Quiz (take out a sheet of paper) 1. What are the 3 parts that make up a nucleotide? 2. Name the 4 bases (Letters are fine). Show which bases bind with each other 3. What is the name of the enzyme that unzips DNA during replication? ► BONUS Early scientists designed experiments to test if ______ or ______ caused transformation.Early scientists designed experiments to test if ______ or ______ caused transformation.

► RNA and Transcription A.Central Dogma of Molecular Biology B.The Structure of RNA C.Transcription D.Types of RNA E.Role of DNA and RNA Presentation outline Go to Section:

Purpose of DNA ► DNA holds the genetic information.  A blueprint for the cell  It tells the cell what to build ► The purpose of DNA  DNA codes for the proteins that make up an organism ► The other day we talked about replicating (copying) DNA ► Today, we talk about the steps to make proteins (building materials) from DNA

Central Dogma of Molecular Biology 1. DNA 2. RNA 3. Protein

But how does DNA store the info? ► DNA is made up of nucleotides ► Nucleotides consist of:  A phosphate  A sugar (deoxyribose)  A base (A,T,C,G) ► How could DNA code for a protein? ► Let’s look at the structure of DNA again!

Hydrogen bonds Nucleotide Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Structure of DNA Go to Section:

The sequence of bases ► The varying sequence of bases is like a code ► You can compare it to the alphabet and words ► For example, we have 26 letters in the alphabet. If you combine the letters into certain sequences you can get a word with a meaning  Uoy rea unfny  You are funny

The sequence of bases ► The same thing can be said about DNA ► The sequence (order) of bases determine the type of protein produced  ACTTCGATCGGTCAGTCAGTCAGTTACGAT  Black colored hair

Information, Please ► DNA contains the information that a cell needs to carry out all of its functions. In a way, DNA is like the cell’s encyclopedia. Suppose that you go to the library to do research for a science project. You find the information in an encyclopedia. You go to the desk to sign out the book, but the librarian informs you that this book is for reference only and may not be taken out.

Information, Please ► Why do you think the library holds some books for reference only? ► If you can’t borrow a book, how can you take home the information in it? ► All of the parts of a cell are controlled by the information in DNA, yet DNA does not leave the nucleus. How do you think the information in DNA might get from the nucleus to the rest of the cell?

RNA DNA RNA polymerase Transcription Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) Go to Section:

Transcription ► DNA cannot exit outside of the nucleus ► Instead a copy (message) must be made so it can be sent out ► RNA polymerase copies the DNA into RNA (message) ► NOTICE: NO “T” in RNA sequence

Structural differences between DNA and RNA ► DNA  Double stranded  Sugar ► deoxyribose  Consists of bases ► A,T,C,G  Located in the nucleus ► RNA  Single stranded  Sugar ► ribose  Consists of bases ► A,U,C,G  Can exit the nucleus into the cytoplasm of the cell

fromtoto make up Different types of RNA also calledwhich functions toalso called which functions to can be RNA Messenger RNA Ribosomal RNA Transfer RNA mRNACarry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome DNARibosomeRibosomes Go to Section:

The Genetic Code Go to Section:

Review 1. DNA to DNA - Purpose of DNA replication  To make copies of the DNA for cell division 2. DNA to RNA – Purpose of transcription  To make a copy of the blueprint that codes for the amino acids (proteins) 3. RNA to protein – Purpose of translation???

2 day Classwork (worth 40 points) ► Create one an informational poster that shows how transcription and translation work ► One side or one half  Transcription ► Other side or other half  Translation ► Must be in color and provide original diagrams ► No more than 4 in a group

Homework ► Create a cartoon of transcription  Use at least an 8 panel cartoon to show how transcription works.  Be creative