Exercise I: Isolation Analysis Plasmid DNA

Slides:



Advertisements
Similar presentations
Lab Report Review Title: Hypothesis Materials Procedure Data Table
Advertisements

Overview of Procedures for Biology Project Amplifying the GAPC Gene from Diverse Plant Species.
BCM208 Metabolic Biochemistry Topic 7: Gene metabolism and Expression.
Pages 2 to 7: Playing cards for Memory and Total recall Pages 2 to 4: keyword-cards Pages 5 to 7: keyword-cards with corresponding explanation-cards Page.
Preparation of competent E. coli cells Transformation of the ligated construct into E. coli Purification of the digested fragment Purification of the pBR322.
TECHNIQUES IN ANSWERING BIOCHEMICAL QUESTIONS, WITH SPECIAL REFERENCE TO NUCLEIC ACIDS Larissa Assam (SUNY Oswego) Dr. Dhrubajyoti Chattopadhyay (University.
Practical #2: Extraction of genomic DNA from E.Coli Practical #3: Agarose Gel Electrophoresis Bertrand Ong Chan JianPeng Salanne Lee.
The construction of cells DNA or RNA (dNTP or NTP) Protein (amino acid) Carbohydrates ( 單醣 雙醣 多醣 ) Lipid etc. ( 生物膜 )
DNA Laboratory SUNY College at Oneonta Dr. Nancy Bachman.
General Laboratory Procedures and Safety Considerations Dr.Abdel Hady Dr.Hany.
Rec. DNA Lab Week 2 Restriction Digestion and Agarose Gel Electrophoresis.
Preparation of competent E. coli cells Preparation of probes by PCR Digestion of pBR322 and plasmid with restrionenzymes BamH1, EcoR1 and EcoRV Purification.
DNA Analysis Using Agarose Gel Electrophoresis Day 1
Basic Procedures for DNA analysis I) DNA isolation & purification: –Sample: nucleated cells –Principle: A- PURIFICATION STEPS: 1.Cell lysis 2.Removal of.
Plasmid DNA Isolation Exercise 8.
Mini-Prep Plasmid Isolation and Identification. Page 3-53 in lab manual & handout.
بعض الأجهزه المستخدمة في الوراثة الجزيئية Explanation of some equipment and operation ways.
Experiment 4- Gene Expression Study in Arabidopsis Thaliana.
Mini-Prep Plasmid Isolation and Identification. Page 3-53 in lab manual & handout.
Principles and Processes
Elucidation of the Bile Salt Sensitivity Gene Locus in Escherichia coli Angeline Satchell, Anna Graves, Sandra Leke-Tambo, Rachael Scott, Jonna Whetsel,
Cloning a DNA segment from bacteriophage lambda Recombinant DNA transformed into bacterial cells Preparation of X-gal plates - by Dr. Soukup before lab.
Purification of DNA from a cell extract In addition to DNA, bacterial cell wall extract contain significant quantities of protein and RNA. A variety of.
Topic 7: Cellular Genetics. Exercise II Mitosis Cell Cycle Exp: Cell cycle onion tips Topic: DNA Exercise I: Isolation Analysis Plasmid DNA.
Nucleic Acid Purification : Its Principle and Miniaturization MEC seminar Apr. 13 Ji Youn Lee.
Onion root tip and Whitefish
CAPE Biology Workshop on Concepts in Biotechnology & Genetic Engineering Prepared and presented by Dr. Marcia E. Roye.
Biotechnology l Introduction l Tools l Process l Applications.
5‘- AGAGTTTGATCCTGGCTCAG - 3’ 1492R 5'- GGTTACCTTGTTACGACTT - 3’ 785F
Cloning, Sequencing and expression in Escherichia coli of the Rubredoxin gene from Clostridium pasteurianum Mathieu, I., Meyer, J., and Moulis, J. (1992)
Chapter 10 Gene Isolation and Manipulation
Playing cards for Memory and Total recall Pages 2 to 4: keyword-cards Pages 5 to 7: keyword-cards with corresponding explanation-cards.
T9: Molecular Characterization of an Unknown P-element Insertion in Drosophila melanogaster.
Cool Cell Cycle video Link: Video IIFmg IIFmg LINK FOR ONION ROOT TIP LAB:
Treatments that stimulate the E.coli. to take up foreign plasmids include: 1.CaCL2 treatment 2.Heat shock 3.Incubation with ECORI 4.1 and and 3 6.All.
MISS :Salsabeel AL Jou jou
?. gfp-gene as cDNA in a host-DNA-fragment E. coli (new host)  gfp ? ??????? Aequorea victoria (donor) host.
(A) DNA ligase (B) DNA polymerase (C) RNA polymerase (D) Restriction enzyme (E) Reverse transcriptase Enzyme used during replication to attach Okazaki.
DNA Technology. I. Vectors: Things used to transport genes into cells.
Source : Genetics Home Reference. Source :
Section II. DNA isolation and analysis 1. Plasmid prep 2. Nucleic acids-RNA, DNA 3. Agarose Gel 4. BioEdit - 소개 Working with DNA- DNA cloning Section III.
DNA Isolation. Nucleic Acid Structure & Function DNA & RNA are composed of Nucleotides A nucleotide consists of three covalently-linked parts: –A nitrogen.
Plasmid mini prep DNA electrophoresis Transformation(Expression)
Build-a-Gene X Edit. Two projects Traditional method – Using site-directed mutagenesis to edit a gene – Make red fluorescent protein brighter – Weeks.
Mitosis lab Onion Root Tip Mitosis. 1. What type of cells are these? 2. How do you know? 3.What phase of the cell cycle are most cells likely to be in?
Extraction and Determination of Bacterial Proteins.
Mini-Prep Plasmid Isolation and Identification
Lab no. 10 Plasmid DNA isolation.
Biochemical experiment Gel extraction & Ligation
Molecular Biology Working with DNA.
Cell Cycle, Mitosis and Meiosis
Cell Cycle -the cell cycle is the process a cell undergoes when it is dividing -there are two main phases during the cell cycle: -interphase: the cell.
Mini-Prep Plasmid Isolation and Identification
Plasmid DNA Isolation.
Agarose Electrophoresis of Plasmid DNA
Sporadic occurrence of CMY-2-producing multidrug-resistant Escherichia coli of ST- complexes 38 and 448, and ST131 in Norway  U. Naseer, B. Haldorsen,
DNA Extraction from Blood
Molecular Biology 361 BCH.
Cloning a DNA segment from bacteriophage
Plasmid DNA Isolation Exercise 8.
Molecular Biology Working with DNA.
Genetically Modified Organisms
Isolation and characterization of enteroaggregative Escherichia coli (EAggEC) by genotypic and phenotypic markers, isolated from diarrheal children in.
Plasmid DNA Isolation Exercise 8.
Lab no. 10 Plasmid DNA isolation.
Agarose gel electrophoresis of DNA extracted from EDTA and formic acid decalcified bone marrow trephine biopsies. Agarose gel electrophoresis of DNA extracted.
Plasmid DNA Isolation.
Plasmid DNA Isolation Exercise 8.
Fig. 5 Enzyme activity of PE-DNase I/Pt tuned by changing temperature or NIR light. Enzyme activity of PE-DNase I/Pt tuned by changing temperature or NIR.
Degradation of plasmid DNA and a reduction of copy numbers of blaCTX-M-15 occur in extended-spectrum-β-lactamase-producing E. coli exposed to copper but.
Presentation transcript:

Exercise I: Isolation Analysis Plasmid DNA Topic 8: DNA Exercise I: Isolation Analysis Plasmid DNA Topic 7: Cellular Genetics. Exercise II Mitosis Cell Cycle Exp: Cell cycle onion tips

Structure of Escherichia coli.

Two strains of E.coli: pBR322 and pUC18.

Purification Plasmid DNA 1:

[Note on pipetting:]

Purification Plasmid DNA 1:

Purification Plasmid DNA 1:

Spin and remove most contaminants:

Purification Plasmid DNA 2:

[Addition of very small volumes:]

DNAse and RNAse treatment:

Preparing the Agarose gel:

Agarose Gel.

Electrophoresis:

Electrophoresis:

Electrophoretic Mobility of Nucleic Acids:

pBR322 pUC18 ET D R ET D R

pUC18 pBR322 ET D R ET R D

MITOSIS: Onion root tip.

Onion root tip.

Onion root tip.