Protein Synthesis An intro to this section!. Transcription Making RNA from DNA 296-297; 300-303.

Slides:

Advertisements

Similar presentations

Cell Division, Genetics, Molecular Biology

Advertisements

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

6.3 Translation: Synthesizing Proteins from mRNA

From gene to protein. DNA:nucleotides are the monomers Proteins: amino acids are the monomers DNA:in the nucleus Proteins:synthesized in cytoplasm.

PROTEIN SYNTHESIS.

Making Proteins Cell Structure (80% of cell membrane is proteins) Transport Channels Cell Processing Hormones (signals) Enzymes What else?

Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).

Protein Translation From Gene to Protein Honors Biology Ms. Kim.

Protein Synthesis. Review! What are some functions of proteins? What are some functions of proteins? Enzymes, which speed up chemical reactions Enzymes,

Protein Synthesis Using RNA to make proteins. Going from DNA to Proteins Let’s review what we’ve done so far: We take our DNA and convert it into RNA.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

Chapter 13.2 Ribosomes and Protein Synthesis

TRANSLATION NOTES.

DNA transcribes to RNA RNA translates to protein.

CFE Higher Biology DNA and the Genome Translation.

1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.

General Biology Notes TRANSLATION A.K.A. PROTEIN SYNTHESIS

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

Use the SUMMARY OF PROTEIN SYNTHESIS handout during this section of notes.

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

PROTEIN SYNTHESIS The formation of new proteins using the code carried on DNA.

RNA AND PROTEIN SYNTHESIS

Adv Biology 1-2. Translation  Translation-the transfer of information from an RNA molecule into a polypeptide. Using the information in RNA to make a.

Protein Synthesis: Translation. The Ribosome: Key Points Consists of 2 subunits Large Subunit (60S) Small Subunit (40S) mRNA is clamped by the subunits.

DNA can’t do it alone so it

PROTEIN SYNTHESIS HOW GENES ARE EXPRESSED. BEADLE AND TATUM-1930’S One Gene-One Enzyme Hypothesis.

Translation Section 11-2 cont.. Transcription Translation 20 different amino acids 20 different amino acids A group of three nucleotides in mRNA code.

Decoding the message. DNA and RNA work together to produce proteins Remember: A protein is a specific sequence of amino acids.

Translation. tRNA acceptor site of amino acid tyrosine Anticodon arm Anticodon: recognizes the codon of the mRNA. The recognition is facilitated by complementing.

Protein Synthesis: Transcription & Translation.

12.3 Protein Synthesis (Translation). Watch these animations and try to explain what is going on. ◦Animation 1Animation 1 ◦Animation 2Animation 2.

Translation and Protein Synthesis Notes

An Act in 3 Parts Part 3 - Translation. The Cast The Ribosome In Eukaryotes, it consists of two subunits (40S and 60S) Role: binds to the mRNA and “reads”

Protein Synthesis. DNA mRNA DNA Cannot the nucleus Sends to the cytoplasm via Its base sequence (called a codon) determines the amino acid in proteins.

Step 2 of protein synthesis: Translation “The players” 1.Transfer RNA (tRNA)  Folded into three-lobed shape (clover-like)  At one lobe, resides an anticodon.

RNA Translation.

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

PROTEIN SYNTHESIS The formation of new proteins using the code carried on DNA.

Translation: From RNA to Protein. Overall Picture Protein Processed mRNA leaves the nucleus mRNA mRNA binds to ribosome Ribosome tRNA delivers amino acids.

TRANSLATION. Cytoplasm Nucleus DNA Transcription RNA Translation Protein.

THE THREE TYPES OF RNA. Section 11.2 Summary – pages There are three main types of RNA that help build proteins. # 1 Messenger RNA (mRNA) brings.

Gene Expression II. Translation Overview Conversion of triplet code into polypeptide Takes place at ribosome in cytoplasm Involves all 3 types of RNA.

Transcription, RNA Processing, & Translation

Section 20.2 Gene Expression

Ribosomes and Protein Synthesis

Transcription, RNA Processing, & Translation

TRANSLATION NOTES.

Translation and Protein Synthesis

Triplet code Codon = 3 mRNA bases =codon chart…use mRNA to code

Protein Synthesis PART 2

Amino Acid Activation And Translation.

Biology Chapter 10 Section 1 Part 2

TRANSLATION NOTES.

Transcription Steps to Transcribe DNA:

Protein Synthesis Translation

RNA - TRANSLATION.

Protein Synthesis.

Translation Decoding the message.

Unit 7: Molecular Genetics

GENE EXPRESSION / PROTEIN SYNTHESIS

Ch Protein Synthesis Protein Synthesis Proteins are polypeptides

Higher Biology Unit 1: 1.3 Translation.

Steps of Translation.

Translation: Protein Synthesis

PROTEIN SYNTHESIS.

DNA and the Genome Key Area 3c Translation.

Protein Synthesis.

Presentation transcript:

Protein Synthesis An intro to this section!

Transcription Making RNA from DNA ;

Click for Animation

Let’s Draw it Out

Translation Forming polypeptides ; Interested in playing a game?

From your reading… How many total amino acids are there? How many bases (nucleotides) code for each amino acid? A triplet code known as a codon is found on what strand, DNA or RNA? What is a polypeptide chain made up of? Is the genetic code universal? (Do all organisms use the same codon/amino acid genetic code?) How does the above question relate to the linked history of the life on Earth?

From your reading… What type of RNA transfers amino acids from the cytoplasm to the ribosome? Where is tRNA made? Is tRNA reuseable? tRNA is a strand of RNA nucleotides, what is found at each of its ends? Wobble position=Not Needed Joining of amino acid to the tRNA is performed by what type of molecule? (Specific name is not needed)

From your reading… Where are the rRNA subunits made? The order of sites in the ribosome are E, P, A. P holds: A holds: E does what?: The movement of mRNA and tRNA through the sites requires energy from whom? What type of molecule is the release factor? Why are polyribosomes used?

Translation Converts/transfers information from mRNA into amino acids Amino acids are the monomers of proteins String amino acids together and a protein is made 3 RNAs needed – mRNA (messenger—from nucleus to ribosome) – rRNA (ribosomal—used in the ribosome) – tRNA (transfer—transfers the codons into amino acids using anticodons)

Translation 3 Main Steps 1.Initiation mRNA attaches to the ribosome (with the use of rRNA) rRNA reads the mRNA in groups of 3 nucleotides called codons Translation starts with a special codon – AUG—start codon—initiator

Translation 3 Main Steps 2. Elongation tRNA carries specific amino acid to the ribosome The specific amino acid is determined by the anticodon of tRNA The anticodon pairs with complementary codon on mRNA (Example: codon AUG; anticodon UAC) Peptide bonds form between amino acids, linking them into proteins tRNAs get recycled back to go pick up more amino acids

Translation amino acid tRNA **Draw this! anticodon codon protein (linked amino acids) ribosome

Translation 3 Main Steps 3. Termination Protein is released from ribosome when “stop codon” is reached – 3 stop codons: UAA UAG UGA

mRNA codon chart Let’s Try!! 1.If mRNA codon is CCG, what is the amino acid? 2.If tRNA anticodon is AAC, what is the mRNA codon? What is the amino acid? 3. If the DNA template strand is ATA, what is the mRNA codon? What is the amino acid?

Translation Answers 1.Proline 2. UUG ; leucine 3.UAU ; tyrosine Now…. 1.Use codon chart to complete practice worksheet 2.Draw/analyze/explain Figures:

Click for Animation

Protein Synthesis DNA: TACACCTTCGCGCAATACTGC mRNA: AUGUGGAAGCGCGUUAUGACG AA: START-TRY-LYS-ARG-VAL-MET-THR START=METHIONINE