04/07/101 Aflatoxin,Tobacco, and the p53 Tumor Suppressor Gene: Cancer's Missing Link? Kerry Scott Lane M.D. Copyright September 21, 2000 North Carolina.

Slides:



Advertisements
Similar presentations
Zeroing in on Non-Small Cell Lung Cancer: Integrating Targeted Therapies into Practice.
Advertisements

1 Aflatoxin exposure, health impacts, risk assessment and database Aflatoxin Stakeholders’ Workshop 3-4 December, 2012 Dar es Salaam, Tanzania.
Yan Guo Assistant Professor Department of Cancer Biology Vanderbilt University USA.
Etiology of cancer: Carcinogenic agents
Part I Introduction of CCOA. CCOA - Chinese Cereals and Oils Association ● CCOA, a national scientific and technical organization for the cereals and.
DISEASE AND PANDEMICS Brijesh Patel.
Understanding Complex Traits in Maize through Structural and Functional Genomics Georgia Davis.
The Loss of the Cell Cycle Control in Cancer
CANCER. What is Cancer? Generic term to describe diseases in which abnormal cells divide without control. It is the number 2 leading cause of death in.
AFLATOXIN REGULATORY ISSUES Garnett E. Wood, Ph.D. Food and Drug Administration Center for Food Safety and Applied Nutrition Center for Food Safety and.
LO: Be able to describe what gene therapy is and how it could be used.
Cancer Biology Ms. Sneha Singh Department of Zoology, DAVCG, Yamunanagar.
Research Problem In one sentence, describe the problem that is the focus of your classroom research project about student learning: Debate as to whether.
NOTES: CH 18 part 2 - The Molecular Biology of Cancer
GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCC TGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG
Aflatoxin contamination of Groundnut Farid Waliyar Peter Craufurd, T Yellamanda Reddy, Tim Wheeler, K Subramanyam, A Subramaniam, Balaraju, Gareth McGay,
Understanding Cancer. What Is Cancer? Different Kinds of Cancer Lung Breast (women) Colon Bladder Prostate (men) Some common sarcomas: Fat Bone Muscle.
Aflatoxins in Ethiopia
William S. Klug Michael R. Cummings Charlotte A. Spencer Concepts of Genetics Eighth Edition Chapter 18 Cell Cycle Regulation and Cancer Copyright © 2006.
You Are What You Eat CH339K. Life Rule 1: Nobody gets out alive Cover of Science, Sept. 23, 1983.
Environmental Carcinogenesis White Coat Wonders Lisa Lam Zara Khan.
Group Number: 2 Britney Porter, Sandra Nguyen, Eduardo Vargas and Samender Singh Randhawa.
NEOPLASIA Lecture 4 Dr. Maha Arafah. Objectives List the various causes of neoplasm List the various causes of neoplasm.
NEOPLASIA Lecture 3 Maha Arafah, MD, KSFP Abdulmalik Alsheikh, M.D, FRCPC ETIOLOGY OF CANCER: CARCINOGENIC AGENTS Foundation block 2014 Pathology.
10/16/2015C.R. Apap1 Lung cancer: a preventable disease Epidemiology addresses issues related to   Heredity,  Life-style, and  Environment.
Cell Cycle and Cancer.
Matt Baumann, Elizabeth Hervey, Corey Love University of New Mexico Biology of Toxins April 2009.
Effect of feeding type on the occurrence of Aflatoxin M1 in cow milk of high producing Dairy cattle in Sri Lanka. G.S.SUMANASEKARA ASCEND RESEARCH NETWORK.
Effect of mycotoxins in the nutrition of farm animals secondary metabolites of fungi fungi start to produce them under stress conditions some of them are.
Effects of Smoking on Health Prepared by Amr Said Dahroug.
By the end of this lecture, students will learn: 1.What is cancer. 2.Genetics of cancer. 3.Oncogenes 4.Tumor suppressor genes. 5.DNA Repair genes 6.Genes.
Tobacco Smoke and Lung Cancer: A Mechanistic Overview Ryan Ubelhor.
Mycotoxins By Thany Alexander. Mycotoxins are toxic secondary metabolites produced by an organism of the fungus kingdom.
Aflatoxin consumption, Health Effects and HIV: a preliminary report of the St. Markus Hospital and five regions of Ghana Inas K. Mahdi, MPH Candidate University.
Understanding Cancer and Related Topics
CHAPTER 19 THE ORGANIZATION AND CONTROL OF EUKARYOTIC GENOMES Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Section D: The.
Homework #3 is due 11/15 Bonus #2 is posted No class on 11/20.
Examples of Human Cancer Viruses Some Viruses Associated with Human Cancers.
Part II.
Examples of Completed Genomes :. IV. Human Gene Therapy Seeks to treat disease by altering an afflicted person’s genes. A mutant gene may be replaced.
Natasha Adlakha Bio445. Discovery in Breast Cancer Reverse Genetics BReast CAncer Gene Chromosome 13 Tumor suppressor gene Penetrance Familial,
Cancer Martha Moreno A Valeria Elizondo A Regina Carrillo Carola Sada.
Cancer =Uncontrolled cell growth due to gene mutations -Cancer is always genetic, but it is not necessarily inherited.
Cancer. Cancer is a disease of the cell cycle Caused by one or more of the following: Increase in growth signals Loss of inhibitory signals In addition,
Dr. Sarah Al Hamli Assistant Research Scientist Food and Nutrition program Environment & Life Science Research Centre Kuwait Institute for Scientific Research.
Rapid and uncontrollable development and production of cells.
Cell Growth & Division Control of Cell Cycle | Disruptions to Cell Cycle.
AFLATOXIN REGULATORY ISSUES
According to the report, 22% of all cancer deaths are caused due to tobacco. So, it is extremely important to quit consuming tobacco products to prevent.
Biomarkers.
Yeasts and Molds.
Targeting p53 for Oncology Drug Discovery
Cancer.
GENETIC BASIS OF CANCER
Cancer unchecked growth that progresses toward limitless expansion.
Daniela Sia, Augusto Villanueva, Scott L. Friedman, Josep M. Llovet 
CANCER What do you need to know??
breast cancer 2, early onsetpro What does this protein make up or do?
Aflatoxins in Ethiopia
Mutations and Genetic Abnormalities
BIOLOGY 12 Cancer.
Daniela Sia, Augusto Villanueva, Scott L. Friedman, Josep M. Llovet 
Aflatoxins in Ethiopia
Aim What happens when a bacteria or virus mutates?
Aflatoxins in Ethiopia
Human Genome Project, Gene Therapy, and Cloning
1.6 U.6 Mutagens, oncogenes and metastasis are involved in the development of primary and secondary tumours. Tumours are abnormal growth of tissue that.
Specific Tumor Suppressor Genes
Presentation transcript:

04/07/101 Aflatoxin,Tobacco, and the p53 Tumor Suppressor Gene: Cancer's Missing Link? Kerry Scott Lane M.D. Copyright September 21, 2000 North Carolina State University

04/07/102 Aflatoxin And Tobacco  What is Aflatoxin  Natural Production of Aflatoxin  Evidence for Contamination of Tobacco  p53 Mutation as Biomarker  p53 Tumor Suppressor and All Cancers  Aflatoxin and Immunosuppressive States  Future Regulatory Framework (FDA-WHO-TART)  Future Technology Solutions

04/07/103 What is Aflatoxin ? Aflatoxin is a mycotoxin produced by Aspergillus Flavus, Aspergilli and Penicillium fungi. It is an complex aromatic heterocycle. It decomposes at 269 C.(Heat stable). AFB likely survives combustion, especially in ETS. It has profound genetic mutational capabilities due to its sterospecificity.

04/07/104 Natural Production of Aflatoxin  Aspergillus is found worldwide, described as a storage fungus.  Aflatoxin production is favored by heat and humidity.  Likely contamination of tobacco is episodic, random, and even microscopic.  Regulated by FDA on corn, grain, peanuts, since late 1960s. Also regulated by EU countries.  Max. permissible level for corn is 20ppb, milk- 0.5

04/07/105 Evidence for Contamination of Tobacco  Welty and Lucas, NC State 1968  Pattee, NC State 1969  Egypt 1994-El Magrahby  India 2000-Guhtka  Industry Internal Documents-WARF-1967  Combustion Studies- Kentucky 1970s  Combustion Studies-Cincinnati-Lane 1978  Human experiments and p53 biomarkers and adducts.

04/07/106 p53 Mutations as Biomarker  p53 is the “Guardian of the genome” which instructs genetically damaged cells to repair or die.  As a tumor suppressor gene it is a last ditch effort to prevent cancer.  p 53 is the most common mutation in all cancers.  Most typically laboratory cancer experiments use aflatoxin to mutate p53.  Over 10,000 articles on Medline about aflatoxin but none had made the aflatoxin-tobacco connection.

04/07/107 p53 and most Cancers  p53 mutations by aflatoxin at codon 249 AGG to AGT thought to cause liver cancer. (G-T transversions).  Guanines preferentially bound by aflatoxin covalently, especially poly GG, GGG and GCs.  Lung cancer “hotspot” is codon 249, AGG to ATG  WHO-IARC database analysis show substantial mutations in human cancers consistent with aflatoxin etiology.  Dennisenko has shown aflatoxin mutates p53 often consistent with WHO data.  Breast cancer shows similar mutational profile.  Most cancers show p53 mutations.

04/07/108 Lung Cancer Mutational Spectra

04/07/109 p53, Lung Cancer and ETS

04/07/1010 Breast Cancer and Aflatoxin

04/07/1011 Aflatoxin and Immunosuppression  AFB is a carcinogen, teratogen, mutagen, inhibitor of protein synthesis, and is immunosuppressive.  AFB has been shown to increase HIV levels 500%  Smokers have increased HIV levels.  Increased HIV levels correlate with increased infectivity and poorer prognosis.  Therefore, AFB contaminated tobacco is likely contributing to the AIDS pandemic.

04/07/1012 Future Regulatory Framework (FDA-WHO-TART)  WHO FCTC seeks to regulate toxin levels on tobacco products worldwide by  TART-Tobacco-Aflatoxin Reduction Talks  Aflatoxin and mycotoxin contamination of tobacco are prime candidates for a Harm Reduction Strategy.  FDA will likely adopt similar guidelines soon.  Industry Compliance may provide limited legal immunity.

04/07/1013 Future Technology Solutions  Multiple solutions available to limit aflatoxin and mycotoxin production on tobacco products.  Monitoring of AFB and mycotoxin contamination from multiple curing practices will provide valuable data.  Prevention, remediation and terminal testing will result in a less harmful product with less liabilty.  Aflatoxin bioinformatics will yield cancer therapies, vaccines, diagnostic tests, and possibly cures for many human diseases.

04/07/1014 Aflatoxin and Tobacco Questions and Answers