©2001 Timothy G. Standish Isaiah 40:4, 5 4Every valley shall be exalted, and every mountain and hill shall be made low: and the crooked shall be made straight, and the rough places plain: 5 And the glory of the LORD shall be revealed, and all flesh shall see it together: for the mouth of the LORD hath spoken it.

©2001 Timothy G. Standish Getting Meaning From Molecular Data Timothy G. Standish, Ph. D.

©2001 Timothy G. Standish What are Genes? The one-gene, one-enzyme hypothesis has been refined to mean each gene codes for a polypeptide Things get fuzzy when a specific locus codes for more than one polypeptide For the purposes of this class, we will define genes as segments of DNA that are transcribed and associated regions that control their transcription Genes may code for both polypeptides or RNAs

©2001 Timothy G. Standish Determination of Gene Numbers DNA sequences are considered to be the gold standard for determining the number of genes in an organism’s genome The problem is that most organisms have un- sequenced genomes and, even when genomes are sequenced, deciding if a segment of DNA represents a region that is transcribed can frequently be difficult Searching DNA for open reading frames seems to be the most logical way of finding genes, but just because an open reading frame exists does not definitively answer whether it is transcribed

©2001 Timothy G. Standish Indirect Estimates DNA hybridization etc.

©2001 Timothy G. Standish Denaturation and Renaturation Heating double-stranded DNA can overcome the hydrogen bonds holding it together and cause the strands to separate resulting in denaturation of the DNA When cooled relatively weak hydrogen bonds between bases can reform and the DNA renatures TACTCGACATGCTAGCAC ATGAGCTGTACGATCGTGATGAGCTGTACGATCGTG Double-stranded DNA TACTCGACATGCTAGCAC ATGAGCTGTACGATCGTGATGAGCTGTACGATCGTG Double-stranded DNA Renaturation TACTCGACATGCTAGCAC ATGAGCTGTACGATCGTGATGAGCTGTACGATCGTG Denatured DNA Denaturation Single-stranded DNA

©2001 Timothy G. Standish Denaturation and Renaturation DNA with a high guanine and cytosine content has relatively more hydrogen bonds between strands This is because for every GC base pair 3 hydrogen bonds are made while for AT base pairs only 2 bonds are made Thus higher GC content is reflected in higher melting or denaturation temperature Intermediate melting temperature Low melting temperature High melting temperature 67 % GC content - TGCTCGACGTGCTCGTGCTCGACGTGCTCG ACGAGCTGCACGAGCACGAGCTGCACGAGC 33 % GC content - TACTAGACATTCTAG ATGATCTGTAAGATC TACTCGACAGGCTAG ATGAGCTGTCCGATC 50 % GC content -

©2001 Timothy G. Standish Determination of GC Content Comparison of melting temperatures can be used to determine the GC content of an organisms genome To do this it is necessary to be able to detect whether DNA is melted or not Absorbance at 260 nm of DNA in solution provides a means of determining how much is single stranded Single-stranded DNA absorbs 260 nm ultraviolet light more strongly than double-stranded DNA does, although both absorb at this wavelength Thus, increasing absorbance at 260 nm during heating indicates increasing concentration of single- stranded DNA

©2001 Timothy G. Standish Determination of GC Content OD Temperature ( o C) T m = 85 o C T m = 75 o C Double- stranded DNA Single- stranded DNA Relatively low GC content Relatively high GC content T m is the temperature at which half the DNA is melted

©2001 Timothy G. Standish GC Content Of Some Genomes Phage T748.0 % Organism% GC Homo sapiens39.7 % Sheep42.4 % Hen42.0 % Turtle43.3 % Salmon41.2 % Sea urchin35.0 % E. coli51.7 % Staphylococcus aureus50.0 % Phage 55.8 %

©2001 Timothy G. Standish Hybridization The bases in DNA will only pair in very specific ways, G with C and A with T In short DNA sequences, imprecise base pairing will not be tolerated Long sequences can tolerate some mispairing only if -  G of the majority of bases in a sequence exceeds the energy required to keep mispaired bases together Because the source of any single strand of DNA is irrelevant, merely the sequence is important, DNA from different sources can form a double helix as long as their sequences are compatible Thus, this phenomenon of base pairing of single-stranded DNA strands to form a double helix is called hybridization as it may be used to make hybrid DNA composed of strands which came from different sources

©2001 Timothy G. Standish Hybridization DNA from source “Y” TACTCGACAGGCTAG CTGATGGTCATGAGCTGTCCGATCGATCAT DNA from source “X” TACTCGACAGGCTAG Hybridization

©2001 Timothy G. Standish Hybridization Because DNA sequences will seek out and hybridize with other sequences with which they base pair in a specific way much information can be gained about unknown DNA using single-stranded DNA of known sequence Short sequences of single-stranded DNA can be used as “probes” to detect the presence of their complimentary sequence in any number of applications including: –Southern blots –Northern blots (in which RNA is probed) –In situ hybridization –Dot blots... In addition, the renaturation or hybridization of DNA in solution can tell much about the nature of organism’s genomes

©2001 Timothy G. Standish Reassociation Kinetics An organism’s DNA can be heated in solution until it melts, then cooled to allow DNA strands to reassociate forming double-stranded DNA This is typically done after shearing the DNA to form many fragments a few hundred bases in length The larger and more complex an organisms genome is, the longer it will take for complimentary strands to bump into one another and hybridize Reassociation follows second order kinetics

©2001 Timothy G. Standish Reassociation Kinetics The following equation describes the second order rate kinetics of DNA reassociation: kC o t = CCoCCo Concentration of single-stranded DNA after time t Initial concentration of single-stranded DNA Second order rate constant (the important thing is that it is a constant) C o (measured in moles/liter) x t (seconds). Generally graphed on a log 10 scale. C o t 1/2 is the point at which half the initial concentration of single- stranded DNA has annealed to form double-stranded DNA

©2001 Timothy G. Standish Reassociation Kinetics Fraction remaining single- stranded (C/C o ) C o t (mole x sec./l) 1.0 Higher C o t 1/2 values indicate greater genome complexity C o t 1/2

©2001 Timothy G. Standish Reassociation Kinetics 0.5 Fraction remaining single- stranded (C/C o ) C o t (mole x sec./l) 1.0 Eukaryotic DNA Prokaryotic DNA Repetitive DNA Unique sequence complex DNA

©2001 Timothy G. Standish Repetitive DNA Organism% Repetitive DNA Homo sapiens21 % Mouse35 % Calf42 % Drosophila70 % Wheat42 % Pea52 % Maize60 % Saccharomycetes cerevisiae 5 % E. coli 0.3 %

©2001 Timothy G. Standish The Globin Gene Family Globin genes code for the protein portion of hemoglobin In adults, hemoglobin is made up of an iron containing heme molecule surrounded by 4 globin proteins: 2  globins and 2  globins During development, different globin genes are expressed which alter the oxygen affinity of embryonic and fetal hemoglobin Fe    

©2001 Timothy G. Standish Model For Evolution Of The Globin Gene Family Ancestral Globin gene Duplication   Duplication and Mutation   Chromosome 16Chromosome 11   Transposition Mutation                 Duplication and Mutation AdultEmbryoFetusEmbryoFetus and Adult Pseudogenes (  ) resemble genes, but may lack introns and, along with other differences typically have stop codons that come soon after the start codons.

©2001 Timothy G. Standish