Download presentation
Presentation is loading. Please wait.
Published byPercival Hood Modified over 8 years ago
1
©2000 Timothy G. Standish John 5:37 37And the Father himself, which hath sent me, hath borne witness of me. Ye have neither heard his voice at any time, nor seen his shape.
2
©2000 Timothy G. Standish Structure and Analysis of DNA and RNA Timothy G. Standish, Ph. D.
3
DNA mRNA Transcription Introduction The Central Dogma of Molecular Biology Cell Polypeptide (protein) Translation Ribosome ©1998 Timothy G. Standish
4
©2000 Timothy G. Standish Outline 1 How we know DNA is the genetic material 2 Basic structure of DNA and RNA 3 Ways in which DNA can be studied and what they tell us about genomes
5
©2000 Timothy G. Standish Transformation Of Bacteria Two Strains Of Streptococcus Capsules Smooth Strain (Virulent) Rough Strain (Harmless)
6
©2000 Timothy G. Standish Experimental Transformation Of Bacteria The Griffith’s 1928 Experiment - Control + Control - Control OUCH!
7
©2000 Timothy G. Standish Avery, MacLeod and McCarty 1944 Avery, MacLeod and McCarty repeated Griffith’s 1928 experiment with modifications designed to discover the “transforming factor” After extraction with organic solvents to eliminate lipids, remaining extract from heat killed cells was digested with hydrolytic enzymes specific for different classes of macro molecules: NoNuclease YesProtease Transformation?Enzyme YesSaccharase
8
©2000 Timothy G. Standish The Hershey-Chase Experiement The Hershey-Chase experiment showed definitively that DNA is the genetic material Hershey and Chase took advantage of the fact that T2 phage is made of only two classes of macromolecules: Protein and DNA H OH P O HO O NH 2 Nucleotides contain phosphorous, thus DNA contains phosphorous, but not sulfur. H OH O H2NH2NCC CH 2 SHSH H OH O H2NH2NC CH 3 C CH 2 S Some amino acids contain sulfur, thus proteins contain sulfur, but not phosphorous. CysteineMethionine
9
Using S 35 Bacteria grown in normal non- radioactive media T2 grown in S 35 containing media incorporate S 35 into their proteins Blending causes phage protein coat to fall off T2 attach to bacteria and inject genetic material Is protein the genetic material? When centrifuged, phage protein coats remain in the supernatant while bacteria form a pellet The supernatant is radioactive, but the pellet is not. Did protein enter the bacteria?
10
Using P 32 Bacteria grown in normal non- radioactive media T2 grown in P 32 containing media incorporate P 32 into their DNA Blending causes phage protein coat to fall off T2 attach to bacteria and inject genetic material Is DNA the genetic material? When centrifuged, phage protein coats remain in the supernatant while bacteria form a pellet The pellet is radioactive, but the supernatant is not. Did DNA enter the bacteria?
11
OH O CH 2 Sugar H H H A Nucleotide Adenosine Mono Phosphate (AMP) OH NH 2 N N N N Base P O OH HO O Phosphate 2’3’ 4’ 5’ 1’ Nucleotide Nucleoside H+H+ -
12
Pyrimidines NH 2 O N N NH N Guanine N N Adenine N N NH 2 N O N O N Cytosine Purines Uracil (RNA) CH 3 N O N O NH N O N O Thymine (DNA)
13
N O H N O N N H Cytosine H O N N N N N H H Guanine - + + + - - Base Pairing Guanine And Cytosine
14
CH 3 N O N O N H + - Thymine N N N N H N H - + Adenine Base Pairing Adenine And Thymine
15
Base Pairing Adenine And Cytosine N O H N O N N H Cytosine - + - N N N N H N H - + Adenine
16
Base Pairing Guanine And Thymine CH 3 N O N O N H + - Thymine H O N N N N N H H Guanine + + -
17
SUGAR-PHOSPHATE BACKBONE H P O HO O O CH 2 HOH P O O HO O O CH 2 H P O OH HO O O CH 2 NH 2 N N N N O O N NH N N N O NH 2 N B A S E S DNADNADNADNA O H P O HO O O CH 2 HO O H2NH2N N HN N N H H P HO O O CH 2 O O N O H2NH2N N H H2OH2O HOH P O HO O O CH 2 CH 3 O O HN N H2OH2O 5’Phosphate group 3’Hydroxyl group 5’Phosphate group 3’Hydroxyl group
18
©2000 Timothy G. Standish The Watson - Crick Model Of DNA 3.4 nm 1 nm 0.34 nm Major groove Minor groove A T T A G C C G G C T A A T G C T A A T C G - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
19
©2000 Timothy G. Standish Forms of the Double Helix 0.26 nm 2.8 nm Minor groove Major groove C G A T T A G C C G G C T A A T G C T A A T C G A T G C 1.2 nm A DNA 1 nm Major groove Minor groove A T T A G C C G G C T A A T G C T A A T C G 0.34 nm 3.9 nm B DNA +34.7 o Rotation/Bp 11 Bp/turn -30.0 o Rotation/Bp 12 Bp/turn +34.6 o Rotation/Bp 10.4 Bp/turn C G G C C G G C G CG C C G G C C G 0.57 nm 6.8 nm 0.9 nm Z DNA
20
©2000 Timothy G. Standish C-DNA: –Exists only under high dehydration conditions –9.3 bp/turn, 0.19 nm diameter and tilted bases D-DNA: –Occurs in helices lacking guanine –8 bp/turn E-DNA: –Like D-DNA lack guanine –7.5 bp/turn P-DNA: –Artificially stretched DNA with phosphate groups found inside the long thin molecule and bases closer to the outside surface of the helix –2.62 bp/turn Even More Forms Of DNA B-DNA appears to be the most common form in vivo. However, under some circumstances, alternative forms of DNA may play a biologically significant role.
21
©2000 Timothy G. Standish Denaturation and Renaturation Heating double stranded DNA can overcome the hydrogen bonds holding it together and cause the strands to separate resulting in denaturation of the DNA When cooled relatively weak hydrogen bonds between bases can reform and the DNA renatures TACTCGACATGCTAGCAC ATGAGCTGTACGATCGTGATGAGCTGTACGATCGTG Double stranded DNA TACTCGACATGCTAGCAC ATGAGCTGTACGATCGTGATGAGCTGTACGATCGTG Double stranded DNA Renaturation TACTCGACATGCTAGCAC ATGAGCTGTACGATCGTGATGAGCTGTACGATCGTG Denatured DNA Denaturation Single stranded DNA
22
©2000 Timothy G. Standish Denaturation and Renaturation DNA with a high guanine and cytosine content has relatively more hydrogen bonds between strands This is because for every GC base pair 3 hydrogen bonds are made while for AT base pairs only 2 bonds are made Thus higher GC content is reflected in higher melting or denaturation temperature Intermediate melting temperature Low melting temperature High melting temperature 67 % GC content - TGCTCGACGTGCTCGTGCTCGACGTGCTCG ACGAGCTGCACGAGCACGAGCTGCACGAGC 33 % GC content - TACTAGACATTCTAG ATGATCTGTAAGATC TACTCGACAGGCTAG ATGAGCTGTCCGATC 50 % GC content -
23
©2000 Timothy G. Standish Determination of GC Content Comparison of melting temperatures can be used to determine the GC content of an organisms genome To do this it is necessary to be able to detect whether DNA is melted or not Absorbance at 260 nm of DNA in solution provides a means of determining how much is single stranded Single stranded DNA absorbs 260 nm ultraviolet light more strongly than double stranded DNA does although both absorb at this wavelength Thus, increasing absorbance at 260 nm during heating indicates increasing concentration of single stranded DNA
24
©2000 Timothy G. Standish Determination of GC Content OD 260 0 1.0 65 70 75 80 85 90 95 Temperature ( o C) T m = 85 o C T m = 75 o C Double stranded DNA Single stranded DNA Relatively low GC content Relatively high GC content T m is the temperature at which half the DNA is melted
25
©2000 Timothy G. Standish GC Content Of Some Genomes Phage T748.0 % Organism% GC Homo sapiens39.7 % Sheep42.4 % Hen42.0 % Turtle43.3 % Salmon41.2 % Sea urchin35.0 % E. coli51.7 % Staphylococcus aureus50.0 % Phage 55.8 %
26
©2000 Timothy G. Standish Hybridization The bases in DNA will only pair in very specific ways, G with C and A with T In short DNA sequences, imprecise base pairing will not be tolerated Long sequences can tolerate some mispairing only if - G of the majority of bases in a sequence exceeds the energy required to keep mispaired bases together Because the source of any single strand of DNA is irrelevant, merely the sequence is important, DNA from different sources can form double helix as long as their sequences are compatible Thus, this phenomenon of base pairing of single stranded DNA strands to form a double helix is called hybridization as it may be used to make hybrid DNA composed of strands which came from different sources
27
©2000 Timothy G. Standish Hybridization DNA from source “Y” TACTCGACAGGCTAG CTGATGGTCATGAGCTGTCCGATCGATCAT DNA from source “X” TACTCGACAGGCTAG Hybridization
28
©2000 Timothy G. Standish Hybridization Because DNA sequences will seek out and hybridize with other sequences with which they base pair in a specific way much information can be gained about unknown DNA using single stranded DNA of known sequence Short sequences of single stranded DNA can be used as “probes” to detect the presence of their complimentary sequence in any number of applications including: –Southern blots –Northern blots (in which RNA is probed) –In situ hybridization –Dot blots... In addition, the renaturation or hybridization of DNA in solution can tell much about the nature of organism’s genomes
29
©2000 Timothy G. Standish Reassociation Kinetics An organism’s DNA can be heated in solution until it melts, then cooled to allow DNA strands to reassociate forming double stranded DNA This is typically done after shearing the DNA to form many fragments a few hundred bases in length The larger and more complex an organisms genome is, the longer it will take for complimentary strands to bum into one another and hybridize Reassociation follows second order kinetics
30
©2000 Timothy G. Standish Reassociation Kinetics The following equation describes the second order rate kinetics of DNA reassociation: 1 1 + kC o t = CCoCCo Concentration of single stranded DNA after time t Initial concentration of single stranded DNA Second order rate constant (the important thing is that it is a constant) C o (measured in moles/liter) x t (seconds). Generally graphed on a log 10 scale. C o t 1/2 is the point at which half the initial concentration of single stranded DNA has annealed to form double-stranded DNA
31
©2000 Timothy G. Standish Reassociation Kinetics Fraction remaining single- stranded (C/C o ) 0 0.5 10 -4 10 -3 10 -2 10 -1 1 10 1 10 2 10 3 10 4 C o t (mole x sec./l) 1.0 Higher C o t 1/2 values indicate greater genome complexity C o t 1/2
32
©2000 Timothy G. Standish Reassociation Kinetics 0.5 Fraction remaining single- stranded (C/C o ) 0 10 -4 10 -3 10 -2 10 -1 1 10 1 10 2 10 3 10 4 C o t (mole x sec./l) 1.0 Eukaryotic DNA Prokaryotic DNA Repetitive DNA Unique sequence complex DNA
33
©2000 Timothy G. Standish Repetitive DNA Organism% Repetitive DNA Homo sapiens21 % Mouse35 % Calf42 % Drosophila70 % Wheat42 % Pea52 % Maize60 % Saccharomycetes cerevisiae 5 % E. coli 0.3 %
34
©2000 Timothy G. Standish
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.