DNA, RNA, and Protein Section Objectives: By the end of this section of notes your should be able to: Relate the concept of the gene to the sequence of nucleotides in DNA. Sequence the steps involved in protein synthesis. Explain the different types of RNA involved in protein synthesis

Genes and Proteins The sequence of nucleotides in DNA contain information. This information is put to work through the production of proteins. Proteins fold into complex, three- dimensional shapes to become key cell structures and regulators of cell functions. Thus, by encoding the instructions for making proteins, DNA controls cells.

What are Genes You learned earlier that proteins are polymers of amino acids. The sequence of nucleotides in your DNA is a gene that contains the information for assembling the string of amino acids that make up a single protein. (instructions to make a protein) Proteins control an organism: Enzymes, Steroids, Structural Proteins etc.. Are all made from the sequence of letters in your DNA Proteins are polymers made of amino acid monomers Where are proteins made? Ribosomes!!

Protein Structure

Cell organization Things to Remember: Where is DNA located? DNA is in the nucleus DNA contains genes = instructions for making proteins Cells want to keep DNA in the nucleus where it is protected “locked in the vault” How does the code for a protein get to a ribosome if the DNA can’t leave the nucleus?

Passing on DNA information: need RNA RNA like DNA, is a nucleic acid RNA structure differs from DNA structure in three ways. 1. Has ribose sugar instead of deoxyribose (DNA) 2. Replaces thymine (T) with uracil (U) 3. Single stranded as opposed to double stranded DNA Nitrogenous base (A, G, C, or U) Phosphate group Uracil (U) Sugar (ribose)

RNA RNA has a different function than DNA Whereas DNA provides the instructions for protein synthesis, RNA does the actual work of protein synthesis. RNA Function: takes from DNA the instructions on how the protein should be assembled, then—amino acid by amino acid—RNA’s assemble the protein.

Types of RNA 3 types of RNA 1. Messenger RNA (mRNA), single, uncoiled strand which brings instructions from DNA in the nucleus to the site of protein synthesis (Ribosome). 2. Ribosomal RNA (rRNA), globular form, makes up the ribosome –the construction site of proteins (site of protein synthesis); binds to the mRNA and uses the instructions to assemble the amino acids in the correct order. 3. Transfer RNA (tRNA) single, folded strand that delivers the proper amino acid to the site at the right time. Has a specific anticodon that is complementary to the sequence on the mRNA.

From gene to protein protein transcription translation

Protein Synthesis: 2 step process 1. Transcription 2. translation 1.Transcription: DNA -> mRNA In the nucleus, enzymes make an RNA copy of a portion of a DNA strand The main difference between transcription and DNA replication is that transcription results in the formation of one single-stranded RNA molecule rather than a double-stranded DNA molecule. 2. Translation: mRNA -> Protein process of converting the information in a sequence of nitrogenous bases in mRNA into a sequence of amino acids in protein

Transcription Making mRNA from DNA DNA strand serves as the template (pattern) to make the RNA strand match bases U : A G : C Important Enzyme: RNA polymerase- splits the DNA, then attaches a complementary strand of RNA. Afterwards the DNA reattaches

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Double stranded DNA unzips RNA polymerase attaches at a promoter which is a region of DNA that signals the start of a gene. T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA RNA Polymerase matches complimentary RNA bases to the DNA bases on one of the DNA strands (T is replaced with U) U U C G A C A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

RNA Processing Not all the nucleotides in the DNA of eukaryotic cells carry instructions—or code—for making proteins. Genes usually contain many long non-coding nucleotide sequences, called introns, that are scattered among the coding sequences. Regions that contain information are called exons because they are expressed. When mRNA is transcribed from DNA, both introns and exons are copied. The introns must be removed from the mRNA before it can function to make a protein. Enzymes in the nucleus cut out the intron segments and paste the mRNA back together. The mRNA then leaves the nucleus and travels to the ribosome.

RNA Processing:simplified Noncoding segments called introns are spliced out ( coding segment = exons)

Transcription review In your own words define a gene True or False. DNA and RNA are both double stranded. What are the 3 types of RNA? Name the enzyme that unwinds the DNA and creates the mRNA. Write out the complimentary RNA strand for the following DNA molecule: A C G G T A C G T T

Translation: From mRNA to Protein Translation takes place at the ribosome Where are ribosomes found? in the cytoplasm or Smooth ER. Involves 3 types of RNA Messenger RNA (mRNA) Carries the blueprint for construction of a protein from the DNA out of the nucleus Ribosomal RNA (rRNA): Makes up the Ribosome which is the construction site where the protein is made 3. Transfer RNA (tRNA): the molecule delivering the proper amino acid to the site at the right time

The Genetic Code The nucleotide sequence transcribed from DNA to a strand of messenger RNA acts as a genetic message, the complete information for the building of a protein.. Virtually all organisms share the same genetic code

? TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC mRNA codes for proteins in triplets (groups of 3 nucleotides) called codons that specify an amino acid AUGCGUGUAAAUGCAUGCGCC mRNA TACGCACATTTACGTACGCGG DNA Met Arg Val Asn Ala Cys Ala protein ? Codon = block of 3 mRNA bases codon

Transfer RNA molecules serve as interpreters during translation In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide The process is aided by transfer RNAs Each tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the other Anticodon base pairs with codon of mRNA

The Genetic code For ALL life! Code has duplicates Start codon support for a common origin for all life Code has duplicates several codons for each amino acid This “wiggle room” is mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

tRNA structure The tRNA molecule has a complementary codon to the mRNA called an anticodon There is a specific tRNA for each amino acid which are stored in the cell, and line up for use during protein synthesis

mRNA to protein = Translation The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U

From gene to protein

DNA – TAC CAA GGA AGT GCG ATA CAT CGT AGC GGT mRNA- A.A. –