“Comparative Genomics of Chlamydia trachomatis Strains” Sonia Rajput Dr. Dan Rockey Biomedical Sciences Oregon State University October 14, 2006

Significance of Research An improved understanding of chlamydial biology and diversity New approaches to prevention and treatment of chlamydial disease – Mapping of disease associated loci – Rapid analysis and detection of single nucleotide polymorphisms (SNPs) – Model for predictive therapies for genotyping- to be used in clinical settings Comparison of chlamydial genome

Chlamydia What is Chlamydia? – Obligate intracellular bacterial pathogen – Causes STD in humans and many diseases like heart disease, Alzheimer's, cataracts – Chlamydia trachomatis: serovars D-K are major cause of urogenital tract infection worldwide What is comparative genomics? – Comparing genomes of different organisms to understand their biology and evolution – Develop systems for diagnostic therapies C. trachomatis florescent antibody stain

Problems/Solutions Problem: Lack of a system for inactivating or inserting target genes. Cannot “knock out” specific genes of interest Solution: Genome sequence analysis provides information on chlamydial genotypes and phenotypes Problem: Little information on the relationship of the organism to the epidemiology of chlamydial infection Solution: Comparative genomics offers insight into the genotype of individual strains that lead to an associated patient phenotype.

Purpose To identify and evaluate single nucleotide polymorphisms (SNPs) and insertions and deletions between serovars/strains – Strains examined: DUW3, G9301, G9768, DS2923, G11222, G new strains – Identify different genotypes that might be associated with different phenotypes within patients DUW3 Chlamydial genome map

Designing PCR Assays PCR Assays: Designed sequence of nucleotides to discriminate among SNPs and insertions and deletions in DUW3 & G DUW3 G9301

Polymerase Chain Reaction PCR assays determine the beginning and end regions amplified by annealing to DNA template Purpose: Comparison of gene expression in different serovars to determine if same nucleotide sequences are present PCR gel Primers tested against G9301 & DUW3 w/ 100BP ladder

Polymerase Chain Reaction PCR gel Primers tested against G9301 & DUW3 w/ 100BP ladder

Polymerase Chain Reaction PCR gel Primers tested against G9301 & DUW3 w/ 100BP ladder 9, 10- CT 326 w/ G9301 & DUW3 9 10

Results- CT std 2. G G G G G G G G G std 12. DuW3 13. G G GUW DA1 17. Gs G std Rectal Strains Cervical Strains

Results- CT std 2. G G G G G G G G G std 12. DuW3 13. G G GUW DA1 17. Gs G std

Results Gene: CT 326 – 111 bp deletion in G9301 compared to DUW3 – Functional class- Unknown, hypothetical protein – Primers: 5’ CCTCTCGGCAATATCCAAAA 3’, 5’ TCTCGTTTGCAACTTGTTCG 3’ Variation among strains in band size produced Due to tissue tropism (rectal vs. cervical)? BLAST: CT326 is a conserved region within these strains of Chlamydia

Gene: CT 456 – 366 bp deletion in G9301 compared to DUW3 – Functional Class: Unknown – Primers 5’ CACCAACGCCATCCTCTATT 3’, 5’ GCTACCACTTCCTCCTGCTG 3’ Not much variation present between strains; wildtype DUW3

Restriction Digest Design 8 primers on PMP genes in G9301 and DUW3 Run restriction digest Purpose: – To observe variation or areas of conservation among strains – Statistically connect variations in SNPs with phenotypes Long term goal: Rapid and simple detection and analysis of SNPs to be used in novel predictive genotyping therapies.

CT681 Highly variable PMP gene from wildtype DUW3 to G9301 Functional class: Major outer membrane protein Primers: F:5’ AGGCATCCTTAGTTCCTGTCGC 3’, R:5’ CGCTTTGAGTTCTGCTTCCTCC 3’ Enzyme: MspI (New England Biolabs) cuts on SNP in G9301, not in DUW3 (12 hrs) Estimated band size produced: G9301: 761bp; DUW3: 758bp Perform on: Ds2923, E11023, and strain A to see variation or distinctions among isolates Lane: bp ladder 2. DUW3 w/o MspI 3. DUW3 w/ MSPI 4. G9301 w/o MspI 5. G9301w/ MSPI 6. G111 w/ MSPI (r) bp ladder 8. GUW57 w/ MSPI (cx) 9. Gs459 w/ MSPI (cx) 10. G1455 w/ MSPI (r)

Conclusion Laboratory and clinical studies have revealed differences in host-pathogen interactions within various Chlamydia trachomatis serovars. The sequence of Chlamydial serovars displaying differences in tissue tropism (rectal versus cervical) might lead to a corresponding phenotype. Therefore, rapid analysis and detection of SNPs can be used in novel predictive genotyping therapies, which can detect the onset of a specific Chlamdyial strain/serovar seen in patients.

Acknowledgements Howard Hughes Medical Institute Program Dr. Dan Rockey’s Lab Dr. Kevin Ahern Support from the NIH