1. Single Nucleotide Polymorphisms Mrs. Stewart Medical Interventions Central Magnet School

2. Bell Work Why is Taq polymerase used in PCR instead of human polymerase? Answer on your own paper

3. Objective Use laboratory techniques such as DNA extraction, PCR, and restriction analysis to identify single base pair differences in DNA Explain how single base pair changes called single nucleotide polymorphisms (SNPs) can be identified through genetic testing and often correlate to specific diseases or traits.

4. Single Nucleotide Polymorphisms The parts of the human genome that vary by just a single nucleotide Abbreviated as SNPs Pronounced as “snips”

6. Effect of SNPs Non-coding DNA regions = no effect Genes that code for proteins = potentially changing the protein produced –Different phenotypes –Disease/disorder EFFECTEFFECT EFFECTEFFECT

7. Remember: a change in DNA can lead to a change in a protein If the protein plays a role in keeping you healthy, serious consequences may occur.

8. Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability Lab Overview

9. Gene of Interest TAS2R38 On chromosome #7 Ability to taste “bitter”

10. What is your phenotype? Weak Taster Non- Taster Strong Taster

11. Step 1: Isolate a sample of your DNA from your cheek cells

12. Step 2: Amplifying the Gene of Interest Using your DNA sample, you will amplify a 220 base pair region of the PTC gene using PCR. –Specific primers attach to either side of the target sequence

13. SNPs for TAS2R38 gene In this lab, you will investigate one of the base pair changes or single nucleotide polymorphisms (SNPs) that affects a person’s ability to taste the chemical PTC.

14. Genetics Review – Question 1 The inability to taste PTC is a recessive trait. If a capital “T” is is used to designate the dominant allele and a lowercase “t” is used to designate the recessive allele, what is the genotype of a “Nontaster”?

15. Answer A “Nontaster” carries two recessive alleles and thus has the genotype “tt”.

16. Genetics Review – Question 2 What are the possible genotypes for a “Taster”?

17. Answer A “Taster” may be homozygous dominant with a genotype of “TT” or heterozygous with a genotype of “Tt”. In this lab, you will use the tools of molecular biology to determine your genotype for PTC tasting.

18. Step 3: Restriction Analysis Restriction enzymes, molecular scissors, recognize specific DNA sequences and cut the nucleotide strands. In this part of the experiment, you will use a specific restriction enzyme, HaeIII, to identify a SNP or base pair difference in the amplified segment of the PTC tasting gene.

19. HaeIII and TAS2R38 gene HaeIII restriction enzyme –5’ GGCC5’ ---GG CC--- 3’ –3’ CCGG3’ ---CC GG--- 5’ TAS2R38 gene variations NONTASTER (tt)TASTER (TT) GGCGGGCACTGGCGGCCACT CCGCCCGTGACCGCCGGTGA

20. Step 4: Gel Electrophoresis Gel Electrophoresis separates DNA fragments based on their molecular weight. Once you have digested your DNA sample with the restriction enzymes, run your product on a gel to analyze your results.

22. What will gel results show? Non-taster Taster