Sequencing Tomato Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 Antonio Granell IBMCP, Valencia

 Estimated euchromatin size : 16 Mb  Number of linked markers: 180  Projected BACs for sequencing: 164  Starting point for sequencing chromosome 9:  264 BACs with anchor markers ( Hind III library)  40 anchor markers but 13 near centromere (141 BACs) 27 anchor markers for selecting seed BACs on the euchromatin sequence (123 BACs) Tomato chromosome 9 Anchor Markers cLPT4C24 TG9 Brix925 SSR70 TG18 T0863 T1680 cTOB1K3 T0765 T1177 T1212 T1416 T1412 cLEB8N3 T1407 T0732 TG186 CT74cLET42O2 T1519 C2_At3g24050 TG328 TG591 T0486 T0521 CT220 T1514 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Marker-BAC association  Design primers for PCR amplification of 25 (out of 27) anchor markers from ~ 70 BAC clones (out of 123)  Sequence BAC ends from ~ 40 BAC clones Marker-BAC association was not confirmed for 10 anchor markers - No PCR product - No marker sequence at the BAC ends Marker-BAC association was confirmed for 15 anchor markers 15 seed BACs to verify location on Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

 We sent 8 BACs  Le_Hba 0107D15 sent from another group, close to euchromatin-herochromatin border on Chr9 9 seed BACs located on Chr9 by FISH  FISH by Stephen Stack lab, Colorado FISH Mapping Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

ILs Mapping S. pennellii ILs  PCR amplification of 15 anchor markers from BACs and ILs  Amplicon sequencing  Sequence alignment IL9-1-3 IL9-1 IL9-1-2 IL9-2 IL9-2-5 IL9-2-6 IL9-3-1 IL9-3-2 IL9-3 Example: Le_HBa0203J14, TG9  15 seed BACs to map: No polymorphism found in two markers 13 seed BACs confirmed as located on Chr9 by sequencing ILs Le_Hba0203J14 GGCCAACACTGGAAAACACAACTAGGTAGATGGCTATTAGACCAT IL3-4 GGCCAACACTGGAAAACACAACTAGGTAGATGGCTATTAGACCAT IL9-1 GGCCAATACTGGAAAACACAACTAGGTAGATGGCTTCTCTACCATCACACTATACTAAAT 180 IL9-1-2 GGCCAATACTGGAAAACACAACTAGGTAGATGGCTTCTCTACCATCACACTATACTAAAT 180 ****** **************************** ********* Le_Hba0203J GTACTTTACTAAATCTGAGTGC 185 IL GTACTTTACTAAATCTGAGTGC 185 IL9-1 CTGAATGCTCTTTCACTAGATGAGGCTTCTCTACCATCACACTATTCTAAATCTGAATGC 240 IL9-1-2 CTGAATGCTCTTTCACTAGATGAGGCTTCTCTACCATCACACTATTCTAAATCTGAATGC 240 *** * ********** *** Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Selected Seed BACs  Marker-specific amplification by PCR and sequence verification  Location on Chr9 confirmed by : FISH only: 2 Sequencing Ils only: 6 FISH and sequencing Ils: 7  Verified BEs (if possible)  We selected 15 seed BACs: Arrows show aproximate BAC location based on Tomato-EXPEN 2000 map Big GAP: 36 cM without seed BACs Distance between some BACs: 2 cM Uneven distribution Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

 BLASTN against BAC end sequence database at Cornell University No candidates found in some cases Too large overlaps in some cases  FPC data from Hind III and Mbo I libraries at Sanger Institute Some of our BACs are not in a FPC contig FPC contigs are too poor to find good candidates in some cases Selection of extension BACs  Selection is based on: Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

REQUESTED 2 BACs FISH 1 BAC IMPOSSIBLE TO MAP BY ILs LINES Summary NEW SEED BACs NEEDED Number of BACs in progress decreasing IN PROGRESS 12 BACs 15 seed BACs 18 extending BACs COMPLETE 21 BACs No extending BACs in 8 cases More than 20 kb overlap in 4 BACs Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Le_HBa0059I05 Le_HBa0176I09 Le_HBa0226J12 SL_MboI0017K18 Le_HBa0038L16 SL_MboI0104L22 SL_Mbo0058A04 SL_MboI0099J09 Le_HBa0033H16 SL_MboI0037I08 Le_HBa0026I24 Le_HBa0116C14 Le_HBa0168F14 Le_HBa0026P14 Le_HBa0300E15 Le_HBa0203J14 Le_HBa0317H H 44 SL_EcoRI0001L13 SL_EcoRI0130H12 SL_EcoRI0019J03 SL_EcoRI0004H20 SL_EcoRI0103M07 SL_EcoRI0004D19 SL_MboI094P20 SL_EcoRI0009I15 Current Status of Sequencing Short arm H 97 Le_HBa0107D15 Le_HBa0099F14 Le_HBa0099P03 Le_HBa0109D11 Le_HBa0278J12 Le_HBa0165P17 Le_HBa0022M02 Le_HBa0226D21 Long arm Origin of the clone: Seed BACs Extension BACs Status: Completed BACs BACs in progress “Death points”: No extension BACs More than 20 kb overlap Extension points: Requested extension BACs Possible extension points Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Overall Status To be sequenced 164 In progress 12 Complete 21 % Done 16 Overall Status Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Summary  Additional overgo screening to provide anchored BACs for at least 10 markers for chromosome 9 will be performed by Cornell NEW SEED BACs NEEDED Number of BACs in progress decreasing  Additional screening to provide anchored BACs for at least 30 (SGN, others) markers per will be performed by IBMCP by PCR on BAC pools (Tabata’s lab) or filters (Cornell)  Mapping of 200 BACs containing ORF at both BES on Dani´s ILs  FISH BACs by Hans de Jong Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007

Sequencing and annotation of Tom Chr9 Victoria FernándezSistemas Genómicos Ángela Pérez Antonio GranellIBMCP Roderic Guigó IMIM Francisco Camera Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 EUSOL