Presentation is loading. Please wait.

Presentation is loading. Please wait.

University of Delhi South Campus Akhilesh K. Tyagi Jitendra P. Khurana Paramjit Khurana Arun Sharma National Research Centre for Plant Biotechnology Nagendra.

Published byOliver Fields Modified over 8 years ago

Similar presentations

Presentation on theme: "University of Delhi South Campus Akhilesh K. Tyagi Jitendra P. Khurana Paramjit Khurana Arun Sharma National Research Centre for Plant Biotechnology Nagendra."— Presentation transcript:

1

2 University of Delhi South Campus Akhilesh K. Tyagi Jitendra P. Khurana Paramjit Khurana Arun Sharma National Research Centre for Plant Biotechnology Nagendra K. Singh T. Mohapatra T. R. Sharma K. Gaikwad National Centre for Plant Genome Research Debasis Chattopadhyay Sabhyata Bhatia Indian Initiative on Tomato Genome Sequencing Centromeric Region Heterochromatic Region Euchromatic Region Telomeric Region UDSC & NCPGR NRCPB (0-60 cM) (69-119 cM)

3 Criteria for BAC selection and confirmation 1.Selection of two candidate seed BACs on chromosome 5 specific marker 100 kb or more in size end sequence availability at SGN 4. BAC verification by direct sequencing using two marker/overlapping region-specific primers using vector-specific SP6 and T7 primers 2. Purity check of bacterial stock Hind III fingerprint of DNA isolated from six independent colonies 3. PCR amplification of genetic markers/overlapping region two marker/overlapping region-specific primer pairs 5. Size estimation/confirmation of BAC clone by CHEF analysis of Not I digested BAC DNA 6. Validation of BAC on chromosome 5 using Introgression Lines polymorphism in PCR products SNP detection of non-polymorphic bands

4 Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5 Marker: CT101 Seed BAC: LE_HBa0191B01 Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2: TGTATACTTGCGCCAGTTCAGGG L. esculentum L. pennelliiIL 5-1IL 5-2IL 5-3IL 5-4IL 5-5 Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01 Haplotype 2: L. pennellii, IL 5-1 (M82)

5 cMMarkerAmpli- con size HaplotypesSequence 0CT1011100 bp M82, IL5-2, IL5-3, IL5- 4, IL5-5 -ACCCCTCAATATTTCGCTCCAA TGTATACTTGCGCCAGTTCAGGG L. pennellii, IL5-1 3T1252375 bp M82, IL5-2, IL5-3, IL5- 4, IL5-5 GAATGAAT L. pennellii, IL5-1 7C2At1g602001000 bp M82, IL5-2, IL5-3, IL5- 4, IL5-5 TAGATATGGT CTACCGA-AC L. pennellii, IL5-1 10 cLET-8-B23 (BAC-specific, non-marker region) 360 bp M82, IL5-2, IL5-3, IL5- 4, IL5-5 GGCT-TTTAA--ATCTGCATTI/DGTTTCAGCT...GACT AAAATCAAGGTTGCGGATGCC...ACCAT-ATCI/DAGTA L. pennellii, IL5-1 12T0876110 bp M82, IL5-1, IL5-2, IL5- 3, IL5-4, IL5-5 GA--A AGTTG L. pennellii 15.5cLED-8-G31000 bp M82, IL5-2, IL5-3, IL5- 4, IL5-5 CTCG...GTTTT-...TGA-TAAGTTTGAAAGI/DAAGTI/DI/DATAA TGAAI/DACAAATI/DCTGGGGCACACTGGGA...GGAA......GACT L. pennellii, IL5-1 Confirmation of markers and their assigned seed BAC positions on chromosome 5

6 BAC/MarkerAmplico n size HaplotypesSequence LE_HBa0179K0 9 SP6 ext. 750 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20 TACGTG...TTATGACT CGAACAI/DGACAATAG L. pennellii, IL7-2 T0876 110bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09 GA--A AGTTG L. pennellii, IL7-2 LE_HBa0179K0 9 T7 ext. 550 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20 ACC GTA L. pennellii, IL7-2 SL_MboI0032F0 7 SP6 ext. 700 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0032f07 TCTC...TC...GG...AGTG- TGGAAG ATCAI/DCAI/DTAI/DGA-AT- TTTCA L. pennellii, IL7-2 Reallocation of marker T0876 and its associated BAC positions on chromosome 7

7 SP6 T7 SP6 T7 SP6 T7 HBa0179K09 (108 kb) MboI0032F07 (~140 kb) MboI0052O23 MboI0083J01 MboI0077G20 (92 kb) SP6 9002 bp overlap (100%) 12955 bp overlap (100%) HBa0188L22 HBa0064M20 HBa0102G23 HBa0123J08 HBa0144B20 ~3.5 kb overlap ~1.4 kb overlap Primer pair 1 Primer pair 2 Primer pair 1 Primer pair 2 ~19 kb overlap ~15.5 kb overlap Chromosome 7 T1401 (COS) CT223 (RFLP) 95 cM Clones sequenced to Phase III level Clones sequenced to Phase II level Extension clones verified Red bars indicate the PCR positive nature of BAC clones using respective primer pairs Dotted line indicates the expected overlap Blue line shows the presence of mapped markers on the BAC clones BACs mapped on chromosome 7

8 Single streak of BAC clones from seed BAC library DNA extraction PCR with genetic marker for re-confirmation CHEF-analysis for size estimation Shotgun cloning and sequencing Searching for STCs (Sequence Tag Connector) SGN end- sequence database DNA fingerprinting (HindIII-digested) for BAC stock purity The path for genomic sequencing 1 TACGTG...TTAT 2 CGAACAI/DGACA IL-mapping for chromosome 5-specificity Polymorphism in PCR (digested) products presence of SNP/indels Assembly of sequence BAC annotation Overgo hybridization Selection of extension BAC Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, seed BAC 2: L. pennellii, IL 5-1

9

10 30730288629Total 2133123LE_HBa0245E0515 140392LE_HBa0251J1314 2123124LE_HBa0239D1113 279585LE_HBa0108A1812 187344LE_HBa0006N2011 1602104LE_HBa0131D0410 1841112LE_HBa0040C219 151671LE_HBa0166A028 83041LE_HBa0334K227 151293LE_HBa0169M216 2545160SL_MboI0077G205 27103140LE_HBa0179K094 2860220LE_HBa0042B193 35163151LE_HBa0261K112 199190LE_HBa0191B011 No. of genesUnknownExpressedPutativeKnownClone name S. No. Gene prediction of some BAC clones (by FGENESH)

11 Functional annotation of some BAC clones KNOWN PUTATIVE EXPRESSED UNKNOWN

12 Important genes present on some BAC clones S. No.BAC cloneName of the geneOrganism 1HBa0191B01Putative cytochrome P450O. sativa 2HBa0191B01HAC1 transcription factorA. thaliana 3HBa0051A13Peroxisomal acyl-CoA oxidase 1AL. cheesmanii 4HBa0051A139-cis –epoxycarotenoid dioxygenaseL. esculentum 5MboI0005B15ATP-binding protein At1g60440L. esculentum 6MboI0005B15Pantothenate kinase family proteinL. esculentum 7HBa0261K11Putrescine aminopropyltransferaseL. esculentum 8HBa0261K11 Splicing factor PWI containing protein/ RNA recognition motif L. esculentum 9HBa0042B19Beta fructosidase geneL. pennellii 10HBa0042B19Nematode resistance-like protein (Gro1-6)S. tuberosum 11HBa0179E24Tospovirus resistance protein C (Sw5-C)L. esculentum 12HBa0179E24 Eukaryotic translation initiation factor 5A- 3 L. esculentum 13MboI0037H06 Potyviral capsid protein interacting protein 2a (CPIP2a) N. tabacum 14MboI0037H06UV-damaged DNA binding protein 1 (hp1)L. cheesmanii

13 Highlights 5. Current status of BAC clones from chromosome 5, selected for sequencing * Six finished BAC clones (5 submitted to NCBI) * Nineteen BAC clones in phase II (11 submitted to NCBI) * Thirteen BAC clones in phase I * Six BAC clones at various stages of library preparation and sequencing 4. Finally, 44 BAC clones, covering approximately ~4.4 Mb region, have been mapped 3. Additional twenty one extension BAC clones have also been confirmed 2. Twenty three seed BAC clones have been confirmed 1. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines 6. Two BAC clones from chromosome 7 have also been completely sequenced and submitted to SGN and NCBI 7. Six BAC clones have been sent for FISH

14

15 0 4 7 3 0 7 3 Physical map: issues ChromosomeBAC clones

16 L. esculentum IL 5-2 L. pennellii IL 5-1 L. pennelliiIL 5-1IL 5-2 (M82) SNP-based analyses for confirmation of introgressed fragment of L. pennellii in IL5-2

17 L. pennellii L. esculentum IL-5-2 Marker T0619 (59cM) Confirmation of introgressed fragment of L. pennellii in IL5-2 L. pennelliiIL 5-1IL 5-2 (M82)

Download ppt "University of Delhi South Campus Akhilesh K. Tyagi Jitendra P. Khurana Paramjit Khurana Arun Sharma National Research Centre for Plant Biotechnology Nagendra."

Similar presentations

Chr9 A ntonio Granell IBMCP-Valencia Spain Tomato Sequencing, Madison July 2006.

Chr9 A ntonio Granell IBMCP-Valencia Spain Tomato Sequencing, Madison July 2006.
9 Genomics and Beyond Brief Chapter Outline

9 Genomics and Beyond Brief Chapter Outline
PAA / Solanaceae 2006 - July 23-27, 2006 - Madison, Wisconsin, USA Sequencing the gene-rich space of tomato chromosome 7 Current status of the French effort.

PAA / Solanaceae July 23-27, Madison, Wisconsin, USA Sequencing the gene-rich space of tomato chromosome 7 Current status of the French effort.
Physical Mapping I CIS 667 February 26, 2004. Physical Mapping A physical map of a piece of DNA tells us the location of certain markers  A marker is.

Physical Mapping I CIS 667 February 26, Physical Mapping A physical map of a piece of DNA tells us the location of certain markers  A marker is.
Mining SNPs from EST Databases Picoult-Newberg et al. (1999)

Mining SNPs from EST Databases Picoult-Newberg et al. (1999)
Sequencing Tomato Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 Antonio Granell IBMCP, Valencia.

Sequencing Tomato Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 Antonio Granell IBMCP, Valencia.
16 and 20 February, 2004 Chapter 9 Genomics Mapping and characterizing whole genomes.

16 and 20 February, 2004 Chapter 9 Genomics Mapping and characterizing whole genomes.
Sequencing the Euchromatic Region of Chromosome 5 of Tomato.

Sequencing the Euchromatic Region of Chromosome 5 of Tomato.
Tomato Chromosome 2 PAG 2009 Doil Choi, Korea. Summary of chromosome 2 sequencing 142 cM 129cM CNR (?) 13.0 40.048.0 78.0100.0120.0 142.0 Markers (cM)

Tomato Chromosome 2 PAG 2009 Doil Choi, Korea. Summary of chromosome 2 sequencing 142 cM 129cM CNR (?) Markers (cM)
Compartmentalized Shotgun Assembly ? ? ? CSA Two stated motivations? ?

Compartmentalized Shotgun Assembly ? ? ? CSA Two stated motivations? ?
Tomato Chromosome 8 sequencing at Kazusa DNA Research Institute Erika Asamizu.

Tomato Chromosome 8 sequencing at Kazusa DNA Research Institute Erika Asamizu.
Genome sequencing. Vocabulary Bac: Bacterial Artificial Chromosome: cloning vector for yeast Pac, cosmid, fosmid, plasmid: cloning vectors for E. coli.

Genome sequencing. Vocabulary Bac: Bacterial Artificial Chromosome: cloning vector for yeast Pac, cosmid, fosmid, plasmid: cloning vectors for E. coli.
Human Genome Project Seminal achievement. Scientific milestone. Scientific implications. Social implications.

Human Genome Project Seminal achievement. Scientific milestone. Scientific implications. Social implications.
Today’s Lecture Genetic mapping studies: two approaches

Today’s Lecture Genetic mapping studies: two approaches
BioInformatics (2). Physical Mapping - I Low resolution  Megabase-scale High resolution  Kilobase-scale or better Methods for low resolution mapping.

BioInformatics (2). Physical Mapping - I Low resolution  Megabase-scale High resolution  Kilobase-scale or better Methods for low resolution mapping.
Reading the Blueprint of Life

Reading the Blueprint of Life
20.1 – 1 Look at the illustration of “Cloning a Human Gene in a Bacterial Plasmid” (Figure 20.4 in the orange book). If the medium used for plating cells.

20.1 – 1 Look at the illustration of “Cloning a Human Gene in a Bacterial Plasmid” (Figure 20.4 in the orange book). If the medium used for plating cells.
Presentation on genome sequencing. Genome: the complete set of gene of an organism Genome annotation: the process by which the genes, control sequences.

Presentation on genome sequencing. Genome: the complete set of gene of an organism Genome annotation: the process by which the genes, control sequences.
Mouse Genome Sequencing

Mouse Genome Sequencing
20.1 – 1 Look at the illustration of “Cloning a Human Gene in a Bacterial Plasmid” (Figure 20.4 in the orange book). If the medium used for plating cells.

20.1 – 1 Look at the illustration of “Cloning a Human Gene in a Bacterial Plasmid” (Figure 20.4 in the orange book). If the medium used for plating cells.

Similar presentations

Ads by Google