Presentation is loading. Please wait.

Presentation is loading. Please wait.

International Tomato Genome Sequencing Project

Published bySolbjørg Karina Møller Modified over 5 years ago

Similar presentations

Presentation on theme: "International Tomato Genome Sequencing Project"— Presentation transcript:

1 International Tomato Genome Sequencing Project
Country USA Korea China UK India NL France Japan Spain USA USA Italy 1 2 3 4 5 6 7 8 9 10 11 12 Chromosome Mb 24 26 26 19 12 20 27 17 16 10 13 11 T=220 To sequence BACs 246 268 274 193 120 213 277 175 164 108 135 113 T=2285 0 µm 53.8 Mb 64.7 Mb 64.7 Mb 82.1 Mb 80.0 Mb 80.3 Mb 81.8 Mb 76.4 Mb 83.6 Mb 85.6 Mb 88.5 Mb Euchromatin & 108.0 Mb 70 µm Heterochromatin

2 Indian Initiative on Tomato Genome Sequencing
Telomeric Region University of Delhi South Campus Euchromatic Region UDSC & NCPGR Akhilesh K. Tyagi J. P. Khurana P. Khurana Arun Sharma (0-60 cM) Heterochromatic Region Centromeric Region National Research Centre for Plant Biotechnology Nagendra K. Singh T. Mohapatra T. R. Sharma K. Gaikwad Heterochromatic Region NRCPB ( cM) National Centre for Plant Genome Research Euchromatic Region Debasis Chattopadhyay Sabhyata Bhatia Telomeric Region

3 The path for genomic sequencing
Single streak of BAC clones from seed BAC library DNA extraction DNA fingerprinting (HindIII-digested) for BAC stock purity PCR with genetic marker for re-confirmation IL-mapping for chromosome 5-specificity CHEF-analysis for size estimation Polymorphism in PCR (digested) products presence of SNP/indels Haplotype 1 TACGTG...TTAT 2 CGAACAI/DGACA 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, seed BAC 2: L. pennellii, IL 5-1 Shotgun cloning and sequencing Assembly of sequence Selection of extension BAC BAC annotation Searching for STCs (Sequence Tag Connector) SGN end-sequence database Overgo hybridization

4 Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5
Seed BAC: LE_HBa0191B01 Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2: TGTATACTTGCGCCAGTTCAGGG Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01 Haplotype 2: L. pennellii, IL 5-1 (M82) L. pennellii IL 5-1 IL 5-2 IL 5-3 IL 5-4 IL 5-5 L. esculentum

5 (BAC-specific, non-marker region)
Confirmation of markers and their assigned seed BAC positions on chromosome 5 cM Marker Ampli-con size Haplotypes Sequence CT101 1100 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 -ACCCCTCAATATTTCGCTCCAA TGTATACTTGCGCCAGTTCAGGG L. pennellii, IL5-1 3 T1252 375 bp GA AT 7 C2At1g60200 1000 bp TAGATATGGT CTACCGA-AC 10 cLET-8-B23 (BAC-specific, non-marker region) 360 bp GGCT-TTTAA--ATCTGCATTI/DGTTTCAGCT...GACT AAAATCAAGGTTGCGGATGCC...ACCAT-ATCI/DAGTA 12 T0876 110 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5 GA--A AGTTG L. pennellii 15.5 cLED-8-G3 CTCG...GTTTT-...TGA-TAAGTTTGAAAGI/DAAGTI/DI/DATAA TGAAI/DACAAATI/DCTGGGGCACACTGGGA...GGAA......GACT

6 Reallocation of marker T0876 and its associated BAC positions on chromosome 7
BAC/Marker Amplicon size Haplotypes Sequence LE_HBa0179K09 SP6 ext. 750 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20 TACGTG...TTATGACT CGAACAI/DGACAATAG L. pennellii, IL7-2 T0876 110bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09 GA--A AGTTG LE_HBa0179K09 T7 ext. 550 bp ACC GTA SL_MboI0032F07 SP6 ext. 700 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0032F07 TCTC...TC...GG...AGTG-TGGAAG ATCAI/DCAI/DTAI/DGA-AT-TTTCA

7 BACs mapped on chromosome 7
SP6 SP6 SP6 SP6 T7 HBa0144B20 HBa0123J08 HBa0102G23 HBa0064M20 HBa0188L22 SP6 Primer pair 1 ~1.4 kb overlap Primer pair 2 SP6 T7 ~3.5 kb overlap T7 T7 T7 MboI0077G20 (92 kb) SP6 T1401 (COS) 95 cM Primer pair 1 12955 bp overlap (100%) CT223 (RFLP) T7 HBa0179K09 (108 kb) T7 Primer pair 1 9002 bp overlap (100%) Clones sequenced to Phase III level T7 Clones sequenced to Phase II level MboI0032F07 (~140 kb) Extension clones verified SP6 Red bars indicate the PCR positive nature of BAC clones using respective primer pairs T7 ~19 kb overlap Primer pair 2 ~15.5 kb overlap Primer pair 1 SP6 Dotted line indicates the expected overlap MboI0052O23 MboI0083J01 Green line shows the presence of mapped markers on the BAC clones T7 SP6

8 SNP-based analyses for confirmation of introgressed fragment of L
SNP-based analyses for confirmation of introgressed fragment of L. pennellii in IL5-2 L. esculentum IL 5-2 L. pennellii IL 5-1 (M82)

9 Confirmation of introgressed fragment of L. pennellii in IL5-2
L. esculentum IL-5-2 (M82) L. pennellii IL 5-1 IL 5-2 Marker T (59cM)

10 New seed BACs in IL 5-2 region
37 cM C2_At2g01110 43.7 cM CT227 46 cM T1790 Seed BACs Seed BACs Seed BACs PCR positive using genetic markers Localization on Chromosome 5 yet to be ascertained

11 The selected seed BACs and their extension BACs
Status Clones selected Marker cM Phase I SL_MboI0050C14 Telomeric Region Phase III LE_HBa0191B01 CT101 Phase III LE_HBa0106O06 C2-At1g60440 Phase III LE_HBa0051A13 T1252 3 Phase III SL_MboI0005B15 Library SL_EcoRII0101I15 Euchromatic Region Library SL_MboI0111D17 T1632 4 Short Arm UDSC & NCPGR Phase III LE_HBa0261K11 C2-At1g60200 7 Phase II SL_EcoRI0086I08 Phase III LE_HBa0042B19 cLET-8-B23 10 Phase I LE_HBa0189E17 T0564 11 Phase II LE_HBa0179E24 cLED-8-G3 15.5 Phase III SL_MboI0037H06 Phase I SL_MboI0095J08 Heterochromatic Region Library LE_HBa0074A13 Phase III LE_HBa0058L13 T1592 16 Sequencing LE_HBa0195M17 Library LE_HBa0051A18 Centromeric Region Phase II LE_HBa0027B05 BS4 21 Phase I SL_EcoRI0053P22 Phase I LE_HBa0169M21 T1360 73 Phase I LE_HBa0334K22 cLEX-13-G5 79 Heterochromatic Region Library LE_HBa0138J03 T1746 84 Phase II LE_HBa0166A02 T1777 105 Phase II LE_HBa0168B11 T1541 107 Phase II LE_HBa0040C21 Long Arm Library LE_HBa0025A19 Phase II LE_HBa0131D04 T1584 108 NRCPB Library LE_HBa0100I06 TG69 111 Phase II LE_HBa0006N20 Phase II LE_HBa0108A18 Euchromatic Region Library LE_HBa0019C24 Library LE_HBa0141A12 CT130 115 Phase II LE_HBa0239D11 Library LE_HBa0013H09 Phase II LE_HBa0251J13 TG185 119 Library LE_HBa0028M20 119 Telomeric Region Phase II LE_HBa0245E05 TG597 119 Library LE_HBa0076P16 CT138

12 Physical map: issues Chromosome BAC clones 3 3 4 7 7

13 Important genes present on some BAC clones
S. No. BAC clone Name of the gene Organism 1 LE_HBa0191B01 Putative cytochrome P450 O. sativa 2 HAC1 transcription factor A. thaliana 3 LE_HBa0051A13 Peroxisomal acyl-CoA oxidase 1A L. cheesmaniae 4 9-cis-epoxycarotenoid dioxygenase L. esculentum 5 SL_MboI0005B15 ATP-binding protein At1g60440 6 Pantothenate kinase family protein 7 LE_HBa0261K11 Putrescine aminopropyltransferase 8 Splicing factor PWI containing protein/ RNA recognition motif 9 LE_HBa0042B19 Nematode resistance-like protein (Gro1-6) S. tuberosum 10 Peptide transporter PTR2-B 11 SL_MboI0037H06 Potyviral capsid protein interacting protein 2a (CPIP2a) N. tabacum 12 UV-damaged DNA binding protein 1 (hp1) L. cheesmanii 13 LE_HBa0179E24 Tospovirus resistance protein C (Sw5-C) 14 Eukaryotic translation initiation factor 5A-3

14 Summary 1. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines 2. Twenty three seed BAC clones using 21 markers have been confirmed 3. Sixteen extension BAC clones from 6 nucleation points have been confirmed 4. Finally, 39 BAC clones, covering approximately ~3.0 Mb region, have been mapped 5. Sequencing status of 26 BAC clones * Three finished BAC clones submitted to SGN/NCBI * Five BAC clones in phase III (quality improvement) * Twelve BAC clones in phase II (11 submitted to NCBI) * Six BAC clones in phase I 6. Two BAC clones from chromosome 7 have also been completely sequenced and submitted to SGN and NCBI 7. Three new nucleation points confirmed by presence of genetic marker, to be confirmed on chromosome 5

Download ppt "International Tomato Genome Sequencing Project"

Similar presentations

Chr9 A ntonio Granell IBMCP-Valencia Spain Tomato Sequencing, Madison July 2006.

Chr9 A ntonio Granell IBMCP-Valencia Spain Tomato Sequencing, Madison July 2006.
The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.

The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.
9 Genomics and Beyond Brief Chapter Outline

9 Genomics and Beyond Brief Chapter Outline
PAA / Solanaceae 2006 - July 23-27, 2006 - Madison, Wisconsin, USA Sequencing the gene-rich space of tomato chromosome 7 Current status of the French effort.

PAA / Solanaceae July 23-27, Madison, Wisconsin, USA Sequencing the gene-rich space of tomato chromosome 7 Current status of the French effort.
Physical Mapping I CIS 667 February 26, 2004. Physical Mapping A physical map of a piece of DNA tells us the location of certain markers  A marker is.

Physical Mapping I CIS 667 February 26, Physical Mapping A physical map of a piece of DNA tells us the location of certain markers  A marker is.
1 Sequencing Workshop Koln, October 15, 2008 Toni Granell My apologies for not being here Thanks Joyce Chr9 sequencing update Spain.

1 Sequencing Workshop Koln, October 15, 2008 Toni Granell My apologies for not being here Thanks Joyce Chr9 sequencing update Spain.
Sequencing Tomato Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 Antonio Granell IBMCP, Valencia.

Sequencing Tomato Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 Antonio Granell IBMCP, Valencia.
Expanding the Tool Kit for BAC Extension Summary of completion criteria developed for NSF Tomato Sequencing Workshop January 14, 2007.

Expanding the Tool Kit for BAC Extension Summary of completion criteria developed for NSF Tomato Sequencing Workshop January 14, 2007.
Sequencing the Euchromatic Region of Chromosome 5 of Tomato.

Sequencing the Euchromatic Region of Chromosome 5 of Tomato.
Tomato Chromosome 2 PAG 2009 Doil Choi, Korea. Summary of chromosome 2 sequencing 142 cM 129cM CNR (?) 13.0 40.048.0 78.0100.0120.0 142.0 Markers (cM)

Tomato Chromosome 2 PAG 2009 Doil Choi, Korea. Summary of chromosome 2 sequencing 142 cM 129cM CNR (?) Markers (cM)
Use of FISH in sequencing tomato chromosome 6 René Klein Lankhorst Hans de Jong Korea meeting 2007.

Use of FISH in sequencing tomato chromosome 6 René Klein Lankhorst Hans de Jong Korea meeting 2007.
Compartmentalized Shotgun Assembly ? ? ? CSA Two stated motivations? ?

Compartmentalized Shotgun Assembly ? ? ? CSA Two stated motivations? ?
Tomato Chromosome 8 sequencing at Kazusa DNA Research Institute Erika Asamizu.

Tomato Chromosome 8 sequencing at Kazusa DNA Research Institute Erika Asamizu.
Human Genome Project Seminal achievement. Scientific milestone. Scientific implications. Social implications.

Human Genome Project Seminal achievement. Scientific milestone. Scientific implications. Social implications.
EU-SOL 2008 November 13-16, Toulouse, FRANCE CHROMOSOME 7 SEQUENCING Current status and perspective TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497.

EU-SOL 2008 November 13-16, Toulouse, FRANCE CHROMOSOME 7 SEQUENCING Current status and perspective TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497.
Presentation on genome sequencing. Genome: the complete set of gene of an organism Genome annotation: the process by which the genes, control sequences.

Presentation on genome sequencing. Genome: the complete set of gene of an organism Genome annotation: the process by which the genes, control sequences.
Mouse Genome Sequencing

Mouse Genome Sequencing
SOL Genomics Network Formed in 2003 to answer two questions: – How can a common set of genes give rise to such a wide range of morphologically and ecologically.

SOL Genomics Network Formed in 2003 to answer two questions: – How can a common set of genes give rise to such a wide range of morphologically and ecologically.
Tomato Chromosome 4: A Mapping & Sequencing Update 28 th September 2005 Christine Nicholson Mapping Core Group Welcome Trust Sanger Institute, UK.

Tomato Chromosome 4: A Mapping & Sequencing Update 28 th September 2005 Christine Nicholson Mapping Core Group Welcome Trust Sanger Institute, UK.
SOL 2008 October 12-16, Cologne, Germany CHROMOSOME 7 THE FRENCH CONTRIBUTION TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497 T0676 TM18 CT54 T0966.

SOL 2008 October 12-16, Cologne, Germany CHROMOSOME 7 THE FRENCH CONTRIBUTION TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497 T0676 TM18 CT54 T0966.

Similar presentations

Ads by Google