HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana

Slides:

Advertisements

Similar presentations

Diagnosis with PCR This is a preparation of DNA. We zoomed in a portion of a gene. We know that two primers, Forward and Reverse, will hybridize at specific.

Advertisements

By Eden Maloney HC70AL Spring 2009 WRKY 59 and Agamous-Like 69 Genes.

T-DNA Mutagenesis T-DNA Mutagenesis. Transfer-DNA Mutagenesis: a chemical or physical treatment that creates changes in DNA sequence which can lead to.

Arabidopsis thealiana AT3G56230 AT4G18650 What are the functions of them? Are they important for seed development? Spring 2004 Mariko Onozawa.

Determining the roles of the BTB genes At2g04740, At4g08455, At1g04390, and At2g30600 in Arabidopsis thaliana growth and development. Brandon D. Blaisdell,

The Trihelix Transcription Factor Family Heather Hernandez.

Suppl Figure S1. mMDH genes in At and t-DNA mutant characterization. A) MDHs in Arabidopsis B) T-DNA insertions available At1g53240 mMDH1 At3g15020 mMDH2.

Cloning Promoters Kelli Henry April 27, 2009.

Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.

What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.

At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.

HC70AL Spring 2009 An Introduction to Bioinformatics By Brandon Le & Min Chen April 7, 2009.

Sierra Wolfenbarger John Fowler Rex Cole. Like most plants it completes an “alternation of generation” Diploid to Haploid to Diploid Haploid stage is.

What Are the Methods and Approaches Used Study Knock-Out Mutations? Elaine Chiu Nancy Phang June 4, 2009.

The MYB and BHLH Transcription Factor Families by Elaine Chiu.

Mutations in Arabidopsis Exocyst Gene AtSEC8 Jennie Hines Mentor: John Fowler.

Arabidopsis Experiments

Cells and cell growth Membranes and cell walls Fertilization and embryogenesis Seed development and dormancy Germination Water transport Water relations.

A Hypothesis for the function of gene AT4G23180 in A. thaliana By Nicole Foxworth and Deborah Lee (Ether Fowl Ox)

Background Introduction By Bensen Fan Kristin Gill Maria Garcia.

F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.

HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.

Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.

Introduction of Seed Development and Arabidopsis Embryo Development By Bekah Charney and Thi Nguyen HC70AL Spring 2006.

The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.

Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.

AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p.

The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.

Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.

THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family

Daisy Robinton Matt Emmer Jason Chai

The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.

The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.

Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV.

Genetics & Genotyping By Kristin Gill & Daisy Robinton HC70AL Spring 2009.

Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.

Searching for Genes Important in Seed Development At1g19000 At1g74840 BY: Mike Douglas.

Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.

Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.

NAC Family Genes AT1G01720 AT1G77450

Searching for the Genes that Control Seed Development

a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c

Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?

Emily Eder HC70AL - Spring 2005

Tandem Inserts, Phenotypic Segregation, Hypocotyl Length, and More…

Phylgenetic tree.

Is AT2G23290 Important in Seed Development?

Welcome to the world of two Arabidopsis genes:

The Alfin-like PHD Zinc Finger Transcription Factor Family

Does Gene AT5G19490 Play a vital role in seed development?

HC70AL Final Presentation

Put Your Dukes Up AT5G03220! Studying Embryo Lethality of

HC70AL Oral Presentation

What is AT5G03500? --Background and Structure--

At2G37120: A Gene Exploration

Volume 21, Issue 3, Pages (September 2011)

Rotation review Gaurav Moghe Genetics Program

Arabidopsis Transcription Factor Genes NF-YA1, 5, 6, and 9 Play Redundant Roles in Male Gametogenesis, Embryogenesis, and Seed Development Jinye Mu,

HC70AL Research Presentation

Heat Shock Factor Protein Family of Transcription Factors

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Molecular cloning of pms916 salt hypersensitive T-DNA mutant.

Arabidopsis Thaliana Gene AT5G58610

Volume 7, Issue 1, Pages (January 2014)

SINE insertion in exon 2 of the ATP1B2 gene (ATP1B2:c.130_131ins227).

Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.

Volume 18, Issue 1, Pages (January 2008)

MAB1 encodes a mitochondrial PDC E1β.

Fig. 4. Targeted disruption of STK35 transcripts in mouse.

Volume 7, Issue 8, Pages (August 2014)

Presentation transcript:

HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana Genes AT4g27410 AT5g07680 Salk Lines # 063576 # 006735 Presented By Tim Schulz

----------------------- Outline Overall: What will knocking out these genes tell us about how they function? ----------------------- What are the characteristics of the genes and T-DNA inserts? Plant Genotypes? Plant Phenotypes? What Next?

Structure & Location of AT4g27410  .5kb (Salk) 2435876 2437500 (bp) 261 356 54 83 441 40 641 Promoter UTR Exon Intron Exon UTR Flanking Sequence 3’ 5’ + 167 FW  - 331  RV ~1.4kb Between Primers (w/o T-DNA) ~ 1.6kb Entire Gene (w/o T-DNA)

Structure & Location of AT5g07680  .5kb (Salk) 2435876 2437500 (bp) 217 187 118 278 123 519 158 19 UTR Exon Intron Exon Intron Exon UTR Flanking Sequence 3’ 5’ FW   RV ~750bp (w/o T-DNA) 2436771 2437540 ~ 1.6kb Entire Gene (w/o T-DNA)

Actual T-DNA Locations AT4G27410 – Different From SALK AT5G07680 – Same as SALK Salk’s Report for AT4G27410:  .5kb (Salk) (bp) 261 356 54 83 441 40 641 Promoter UTR Exon Intron Exon UTR Flanking Sequence

Actual T-DNA Locations AT4G27410 – Different From SALK AT5G07680 – Same as SALK My Results for AT4G27410 Show:  .5kb (Salk)  .5kb (Salk) (bp) 261 356 54 83 441 40 641 Promoter UTR Exon Intron Exon UTR Flanking Sequence

Actual T-DNA Location: AT4G27410 PCR Odd Results From FW + RV + LBb1: Plants 6-13

Solution: Separate Primers LB+FW, LB+RV, RV+FW 2 2 2 4 4 4 5 5 5 6 6 6 7 7 7

Actual T-DNA Location: AT4G27410 Conclusion After - Band-Size Analysis - Sequencing:  .5kb (Salk)  .5kb (Salk) (bp) 261 356 54 83 441 40 641 Promoter UTR Exon Intron Exon UTR Flanking Sequence

Genotypes: First SALK Line AT4G27410 Plant 1. W/T 2. Heterozygous 3. W/T 4. W/T 5. W/T 6. Homozygous 7. W/T 8. W/T 9. Heterozygous 10. W/T 11. W/T 12. Heterozygous 13. Homozygous 1 2 1. W/T 3. W/T 5. W/T 7. HOMO 2. HET 4. W/T 6. HOMO 8. W/T 3 4 9. HET 12. HET 11. W/T 10. W/T 13. HOMO

Genotypes: Second SALK Line AT5G07680 Questions: Missing Plants? Smaller Plants?

Phenotypes? Smaller Plants – NAM Related? Missing Plants – Embryo Lethal?

Genotypes: Second SALK Line Plants # 1 2 3 4 5 6 8 9 10 11 12 13 - +

Smaller Plants: Mutants?

Smaller Plants: Mutants?

Smaller Plants: Mutants? The Test: #10 & #24 10 24 - + (Hetero DNA for Positive Control) ~750bp  T-DNA

Genotypes: Second SALK Line AT5G07680 1 2 Plant 1. W/T 2. W/T 3. W/T 4. W/T 5. Heterozygous 6. W/T 7. -- 8. Heterozygous 9. Heterozygous 10. W/T 11. W/T 12. W/T 13. Heterozygous 24. W/T 1. W/T 3. W/T 5. HET 7. (Too Small) 2. W/T 4. W/T 6. W/T 8. HET 3 4 10. W/T 12. W/T 9. HET 13. HET 11. W/T

Phenotypes? Smaller Plants – NAM Related? Missing Plants – Embryo Lethal?

Missing Plants – Embryo Lethal? Analysis through Microscopy Heterozygous Silique Image 1 All Alive: No Immediate affect 3:1 Alive/Dead Ratio- Seed Development affected Zygotically 1:1 Alive/Dead Ratio- Female Gametophyte affected, post fertilization

Missing Plants – Embryo Lethal? Analysis through Microscopy Heterozygous Silique Image 2

Missing Plants – Embryo Lethal? Analysis through Microscopy Heterozygous Silique Image 2 (opened)

Missing Plants – Embryo Lethal? Heterozygous-Embryo Development Early Heart

Missing Plants – Embryo Lethal? Heterozygous-Embryo Development Heart

Missing Plants – Embryo Lethal? Heterozygous-Embryo Development Late Heart

Missing Plants – Embryo Lethal? Heterozygous-Embryo Development Torpedo

Missing Plants – Embryo Lethal? Heterozygous-Embryo Development Walking Stick

Missing Plants – Embryo Lethal? Heterozygous-Embryo Development U-Turn

Where to go from here… Promoter + GFP Multiple Knockouts (determined via microarrays) Other, non-knockout related experiments

----------------------- Conclusion Primary Goal  Know Gene Functionality Primary Method  T-DNA Knockout ----------------------- What are the characteristics of the genes and T-DNA inserts? Plant Genotypes? Plant Phenotypes? What Next?