Is this specific for zebrafish? Or can we learn how to drive stem cells into specific cell types in mammals?

Slides:

Advertisements

Similar presentations

How might we cure diseases in the future?. Using what we know about genes Pharmacogenetics/ Pharmacogenomics Gene Therapy Regenerative medicine.

Advertisements

From ES cells to Neurons: A Road Map to Neurogenesis in the Embryo Elsa Abranches, Domingos Henrique, Evguenia Bekman Unidade de Biologia do Desenvolvimento.

Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.

4.A.3 Cell Specialization Interactions between external stimuli and regulated gene expression result in specialization of cells, tissues and organs.

Detecting Orthologs Using Molecular Phenotypes a case study: human and mouse Alice S Weston.

More regulating gene expression. Fig 16.1 Gene Expression is controlled at all of these steps: DNA packaging Transcription RNA processing and transport.

Comparative Genomics II: Functional comparisons Caterino and Hayes, 2007.

Genome-wide mapping of transcription factor Oct4, Sox2 and Nanog binding-sites in mouse embryonic stem cells Genome Institute of Singapore Department of.

STOP progression PROTECT & REGROW remaining tissues REPLACE damaged tissues A Cure For Wolfram Three Steps 2.0 Fumi Urano, MD, PhD.

An Introduction to ENCODE Mark Reimers, VIPBG (borrowing heavily from John Stamatoyannopoulos and the ENCODE papers)

Second Year (2009) Semester 1 Plants and the Environment ( ) Fundamentals of Cell Biology ( Semester 2 Plant Biodiversity ( ) Ecology.

MicroRNA Control of Appendage Regeneration Benjamin L. King 1,2, Heather Carlisle 1, Ashley Smith 1, Viravuth P. Yin 1,2 1 Mount Desert Island Biological.

Modifying Genes How can they be changed? 1. Genetic Engineering Replacing genes for desired traits… ◦ Must know exact location  Gene map (genome project)

Systems Biology at the Center for BioSystemsAnalysis ZBSA.

Biology Chapter 12 Section 5 Gene Regulation. Objectives ______________a typical gene _________how lac genes are turned off and on __________how most.

More regulating gene expression. Combinations of 3 nucleotides code for each 1 amino acid in a protein. We looked at the mechanisms of gene expression,

Alaina Doran.  Zebrafish (Danio rerio)  Tropical freshwater fish belonging to the minnow family  In late 2003, transgenic zebrafish that express green,

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Moein Farshchian Ph.D Candidate of Cell and Molecular Biology.

The Genetic Basis of Development

Definition: Transgenic Animal Animal in which a segment of DNA has been physically inserted into the genome. The genome of all cells of the organism contains.

Lecture 12. Stem Cells, Nuclear Transplantation, and Combined Cell & Gene Therapy Strategies.

Anis Karimpour-Fard ‡, Ryan T. Gill †,

Research Techniques Made Simple: Generation of complete or tissue-specific knockout mice Lukas Scharfenberger, Tina Hennerici, Gábor Király, Sophie Kitzmüller,

Gene editing in embryos and germ line

Two powerful transgenic techniques Addition of genes by nuclear injection Addition of genes by nuclear injection Foreign DNA injected into pronucleus of.

Stem Cells and the Maintenance of Adult Tissues

In vivo and in vitro zebrafish models for CNS axonal regeneration after injury Abdiel Badillo Jeffery A. Plunkett, Ph.D.

Biotechnology Techniques in Developmental Biology Ch. 5 - Gilbert pp

Research Techniques Made Simple: Zebrafish as a Model System to Study Skin Biology and Pathology Qiaoli Li and Jouni Uitto Department of Dermatology and.

Fanconi Anemia Anthony Winchell. What is Fanconi Anemia?

Biotechnology Techniques in Developmental Biology Ch. 5 - Gilbert pp

1 – 3D atlases of normal craniofacial development (Mouse and Avian) 2 – 3D atlases that define the phenotypes of mutant, transgenic and morpholino-based.

The University of Colorado BioFrontiers

Takahashi and Yamanaka, 2006 Fig 1. Takahashi and Yamanaka, 2006 Fig 1.

How might we cure diseases in the future?

Clinical trial material & ATMPs

Genetic Analysis of Development in Vertebrates

The Art of Capturing Pluripotency: Creating the Right Culture

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Homework #2 is due 10/17 Bonus #1 is due 10/24 FrakenFlowers.

Relationship between Genotype and Phenotype

Volume 11, Issue 2, Pages (August 2012)

The Genetic Basis of Development

Evolutionary genetics

Novel p53 target genes identified by RNA-Seq, pSILAC and ChIP-Seq.

The evolutionary conservation of the phosphoproteomes.a, E. coli. b, B. subtilis. The evolutionary conservation of the phosphoproteomes.a, E. coli. b,

New Insights into Genome Structure: Genes of a Feather Stick Together

Schematic model of effector pathways that mediate tumor suppression by p53. Schematic model of effector pathways that mediate tumor suppression by p53.

Distribution of the phosphoproteins based on GO analysis, including biological process (Left) and cellular component (Right). Distribution of the phosphoproteins.

Bar plot representation of the transcriptomic changes in Δsaci_ptp and Δsaci_pp2a. Bar plot representation of the transcriptomic changes in Δsaci_ptp and.

At Last: Gene Editing in Human Embryos to Understand Human Development

Brandon J. Thomas, Stephen T. Smale Immunity

Direct Pou5f1 and Pou5f1/Sox transcriptional targets have spatially restricted expression domains. Direct Pou5f1 and Pou5f1/Sox transcriptional targets.

Section 1-2 Levels of organization

Pou5f1 is required for proper developmental timing of gene expression.

Targeted disruption of the RapGEF2 gene.

CLONING Sun Hwa Dong.

Proliferation at the Heart of Preadolescence

Fig. 4. transparent encodes Mpv17.(A) tra maps to chromosome 20.

Schematic representation of a transcriptomic evaluation approach.

Circular plots of 20 regulators reveal redundancies and serial inhibition (10, 12). Circular plots of 20 regulators reveal redundancies and serial inhibition.

The zebrafish ortholog of human JunB is expressed in the zebrafish heart. The zebrafish ortholog of human JunB is expressed in the zebrafish heart. (A)

Human ES Cell Profiling Broadens the Reach of Bivalent Domains

iPSC Lines for Purchase

Cell Biology Project.

Global analysis of the chemical–genetic interaction map.

Every 30 seconds, a patient dies from diseases that could be treated with tissue replacement 3D Printing Organs.

Presentation transcript:

Is this specific for zebrafish? Or can we learn how to drive stem cells into specific cell types in mammals?

Overexpression of mouse Pou5f1 rescues zebrafish embryos mutant for Pou5f1 Evolutionary conservation of function

Mouse and zebrafish Pou5f1 share targets: Comparison with mouse Oct4 target sets (genes with homology info only): Sharov et al, BMC Genomics 2008 (Matoba et al., 2006 and Loh et al., 2006) zebrafish mouse

Relevance?

Insight into controlled differentiation of stem cells to replace lost tissues: Regenerative medicine Use knowledge of combination of tissue specific repressors of differentiation to generate defined cell types

Acknowledgements & Rebecca Mössner, Kay Kotkamp, Bozena Polock, Björn Wendik, Esther Kur, Bernadette Lippok, Sungmin Song, Heinz-Georg-Belting, Martina Lachnit Collaborations: Thorsten Kurz (ZBSA Genomics Core) Daria Onichtchouk Florian Geier Jens Timmer (FRIAS) Onichtchouk et al., Molecular Systems Biology, 6:354 Mar