1. MicroRNA Control of Appendage Regeneration Benjamin L. King 1,2, Heather Carlisle 1, Ashley Smith 1, Viravuth P. Yin 1,2 1 Mount Desert Island Biological Laboratory, Salisbury Cove, Maine 04672 USA 2 Graduate School of Biomedical Sciences and Engineering, University of Maine, Orono, Maine 04451 USA Appendage Regeneration The long-range goal of this proposed research is to dissect the molecular regulation of vertebrate limb regeneration, and apply this information toward designing therapies that restore regenerative responses in humans. The inability to regrow functional limbs or limb segments lost to trauma or disease is a significant biomedical problem, with substantial associated monetary and quality-of-life implications for the nearly two million US citizens. Development of therapies to restore regenerative capacity first requires an understanding of the basic gene regulatory networks controlling this biology. While this capacity is limited only to the very distal tips of digits in mammals, adult teolost fish and urodele amphibians have championed regeneration of entire appendages, replacing bone, connective tissue, epidermis, nerves, blood vessels and pigment cells. The key feature that underscores appendage regeneration is the formation of the blastema, a highly proliferative progenitor tissue that arises through dedifferentiation of existing cells. Our goal is to identify a core genetic signature that regulates the formation and maintenance of the blastema by comparing high-throughput RNA sequencing (RNA-Seq) datasets from regenerating axolotl forelimbs, bichir pectoral fins and zebrafish caudal fins. Initiation and progression of appendage regeneration involves modulating multiple genetic programs through regulatory factors. MicroRNAs (miRNAs) are short highly conserved non- coding genes that suppress expression of target genes and thereby control multiple genetic programs. Given the important regulatory roles of miRNAs, and evolutionary conservation, we hypothesize that differentially expressed miRNAs define a conserved genetic regulatory circuit important for appendage regeneration. We found six up-regulated and six down-regulated miRNAs common to all three model systems. The most highly up-regulated miRNA in the three models was miR-21. We are currently analyzing corresponding mRNA-Seq data to find candidate target genes for miR-21 and the other commonly expressed miRNAs. Promising candidate genes include several extracellular matrix and adhesion genes commonly down-regulated in axolotl and bichir. Abstract microRNAs Regulate Regeneration miR-133 Regulates Zebrafish Caudal Fin Regeneration microRNAs Regulate Target Genes Differentially expressed microRNAs define a conserved genetic regulatory circuit important for appendage regeneration. Hypothesis Stages of Regeneration Models of Appendage Regeneration Experimental Design Funding & Acknowledgements This project was supported by grants from the National Institute of General Medical Sciences (P20 GM103423 and P20 GM104318) from the National Institutes of Health, the Department of Defense (W81XWH-11-1-0425) to VPY. We acknowledge Dr. Jim Vincent and the Vermont Genetics Network (P20 GM103449) for assistance with transcriptome assembly analysis. Wound Healing Blastema Formation Yin et al. Genes Dev (2008) High-Throughput RNA Sequencing (RNA-Seq) of Regenerating Limbs 0 dpa 3 dpa 7 dpa (Polypterus)14 dpa 6 dpa (Axolotl) - Study three models of regeneration - Uninjured (0dpa), Wound healing (3dpa), Blastema formation (4/6/7dpa), Outgrowth (14dpa) - Illumina Small RNA-Seq - miRMiner software to annotate microRNAs - Illumina mRNA-Seq - de novo transcriptome assembly and annotation using Trinity package 4 dpa (Zebrafish) MicroRNA Annotation and Expression AnalysismRNA Expression Analysis miR-21 Required for Regeneration qPCR Validation of miRNA Expression Appendage regeneration requires the formation of the blastema after wound healing. The blastema is a highly proliferative progenitor tissue through dedifferentiation that is maintained during outgrowth. 0 dpa 1 dpa 3 dpa Amputation [ ] BrdU Day 1 3 dpa Blastema microRNAs Are Highly Conserved dre-miR-21-5p TAGCTTATCAGACTGGTGTTGGC ||||||||||||||||||||||| pse-miR-21-5p TAGCTTATCAGACTGGTGTTGGC ||||||||||||||| ||||| ame-miR-21-5p TAGCTTATCAGACTGATGTTGAC |||||||||||||||||||||| hsa-miR-21-5p TAGCTTATCAGACTGATGTTGA 12345678901234567890123 Day 1 237 Daily IP injections Amputation Collect samples Procedure Experimental Procedure control, 4dpaanti-miR-21, 4dpa * 1.0 0 4 dpa Regenerate length (mm) 0 QPCR fold-change in miR-21 expression 1.0 0.5 Ct7 dpa30 dpa * * * = t-test p-value <0.001 Axolotl Forelimbs Zebrafish Caudal Fins Conclusions Polypterus Fins Small & Olson Nat Rev Genetics (2004) Target recognition governed by conserved 5p “seed” region (positions 2-8). lungfishAxolotl sarcopterygians amniotes PolypterusAmia actinopterygians Danio We seek to define a conserved genetic regulatory circuit for blastema formation by comparing three models of appendage regeneration. Known Blastema-Associated Genes Novel Blastema-Associated Genes MiR-21 is upregulated in all three models. MiR-21 is required for regeneration in these models. Ongoing analysis of target genes is required to determine miR-21 mechanisms of action. MicroRNAs, such as miR-21, appear to constitute a conserved regulatory circuit for appendage regeneration. Common Predicted miRNA Targete In zebrafish, 36 of 41 genes previously described to be associated with blastema formation were differentially expressed with all but eight up-regulated. MicroRNA Target Gene Analysis Common Differentially Expressed Genes 9,652 (56.2%) of 17,173 zebrafish genes detected in the regenerating caudal fin mapped to Polypterus and axolotl transcriptome assemblies. 1,978 commonly up-regulated, 1,199 commonly down-regulated. Up-Regulated miRNAs 137 down-regulated targets - pdcd4 - tgfbr2 Down-Regulated miRNAs 220 up-regulated targets - stk3 - bax Common Up-Regulated miRNAsCommon Down-Regulated miRNAs miRNA Expression Across Models miRNA Expression in Zebrafish Caudal Fin