12-3 RNA and Protein Synthesis

Slides:



Advertisements
Similar presentations
RNA and Protein Synthesis
Advertisements

CH 11.4 & 11.5 “DNA to Polypeptide”.
RNA and Protein Synthesis
End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology Protein Synthesis: I will understand the general pathway of transcription and translation.
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
RNA Transcription.
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
RNA & Protein Synthesis Intro Genes code DNA instructions that control the production of proteins within the cell. Genes The first step in decoding.
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology.
13.1 RNA.
Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.
RNA and Protein Synthesis
RNA and Protein Synthesis
RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.
VII RNA and Protein Synthesis
RNA. ________ are coded DNA instructions that control the ___________ of proteins. Genetic ______________ can be decoded by copying part of the ___________.
End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis RNA and Protein Synthesis.
The Genetic Code.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis 12–3 RNA and Protein Synthesis.
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Copyright Pearson Prentice Hall
Lesson Overview Lesson OverviewFermentation Lesson Overview 13.1 RNA.
End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis 12–3 RNA and Protein Synthesis.
RNA & Protein Synthesis
Nucleic Acids Comparing DNA and RNA. Both are made of nucleotides that contain  5-carbon sugar,  a phosphate group,  nitrogenous base.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.
Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Genes are DNA instructions that control the.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
End Show 12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 106. What are genes? They are coded.
RNA & Protein Synthesis
Chapter 13 From DNA to Proteins
Notes: Transcription DNA vs. RNA
RNA and Protein Synthesis
CH 12.3 RNA & Protein Synthesis.
RNA & Protein synthesis
Copyright Pearson Prentice Hall
12-3 RNA & Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
From dna to rna.
RNA Ribonucleic Acid.
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Copyright Pearson Prentice Hall
Lesson Overview 13.1 RNA
RNA & Protein synthesis
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Comparing RNA and DNA Each nucleotide in both DNA and RNA is made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base. There are three important.
I will understand the general pathway of transcription and translation
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
4a. Know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA.
Presentation transcript:

12-3 RNA and Protein Synthesis Copyright Pearson Prentice Hall

12–3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be ______________ by copying part of the nucleotide sequence from DNA into RNA. RNA contains coded information for making_________________________. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Structure of RNA The Structure of RNA RNA consists of a long chain of ______________. Each nucleotide is made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Structure of RNA There are three main differences between RNA and DNA: The sugar in RNA is _________________ instead of deoxyribose. RNA is generally ________________-stranded. RNA contains ______________ in place of thymine. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA Types of RNA There are three main types of RNA: _______________________ RNA _______________________RNA Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Messenger RNA (mRNA) carries copies of instructions for assembling _______________________into proteins. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA Ribosome Ribosomal RNA The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Ribosomal RNA is combined with proteins to form ribosomes. Ribosomes are made up of ________________ and _____________________ RNA (rRNA). Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA Amino acid The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Transfer RNA During protein construction, _______________ RNA (tRNA) transfers each amino acid to the ribosome. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Transcription Transcription RNA molecules are ________________ by copying part of a nucleotide sequence of DNA into a complementary sequence in RNA. This process is called __________________________________. Transcription requires the enzyme RNA ___________________________. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Transcription During transcription, RNA polymerase binds to DNA and _________________ the DNA strands. RNA polymerase then uses one strand of __________________ as a template from which nucleotides are assembled into a strand of RNA. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Transcription RNA polymerase binds only to regions of DNA known as__________________________. Promoters are signals in DNA that indicate to the _________________________ where to bind to make RNA. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Transcription RNA RNA polymerase DNA During transcription, RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall RNA Editing RNA Editing The DNA of eukaryotic genes contains sequences of nucleotides, called _________________, that are not involved in coding for proteins. The DNA sequences that code for proteins are called _________________________. When RNA molecules are formed, introns and exons are ____________________ from DNA. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall RNA Editing The introns are _____ out of RNA molecules. The exons are the __________________ together to form mRNA. Exon Intron DNA Pre-mRNA mRNA Many RNA molecules have sections, called introns, edited out of them before they become functional. The remaining pieces, called exons, are spliced together. Then, a cap and tail are added to form the final RNA molecule. Cap Tail Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code The Genetic Code The genetic code is the “language” of mRNA ____________________________. The code is written using ___________ “letters” (the bases: A, U, C, and G). Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code A _________________ consists of three consecutive nucleotides on mRNA that specify a particular amino acid. A codon is a group of three nucleotides on messenger RNA that specify a particular amino acid. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code Each codon specifies a particular amino acid that is to be placed on the __________________chain. Some amino acids can be __________________ by more than one codon. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code The genetic code shows the amino acid to which each of the 64 possible codons corresponds. To decode a codon, start at the middle of the circle and move outward. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code There is one codon_______________that can either specify the amino acid methionine or serve as a ______________codon for protein synthesis. There are three _______________codons that do not code for any amino acid. These “stop” codons signify the end of a polypeptide. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Translation Translation is the ________________ of an mRNA message into a polypeptide chain (protein). Translation takes place on _____________. During translation, the cell uses information from _________________ RNA to produce proteins. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Messenger RNA is transcribed in the ____________, and then enters the ________________ where it attaches to a ribosome. Nucleus During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Translation begins when an mRNA molecule __________________ to a ribosome. As each ________________ of the mRNA molecule moves through the ___________________, the proper amino acid is brought into the ribosome by tRNA. In the ribosome, the amino acid is transferred to the growing polypeptide chain. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Each ____________ molecule carries only one kind of amino acid. In addition to an amino acid, each tRNA molecule has three __________________ bases. These bases, called the ___________________are complementary to one mRNA codon. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation The ribosome binds new tRNA molecules and amino acids as it moves along the mRNA. Lysine Phenylalanine tRNA Methionine Ribosome During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Start codon Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Protein Synthesis Lysine tRNA During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Translation direction Ribosome Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation The process continues until the ribosome reaches a stop codon. Polypeptide Ribosome tRNA During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Roles of RNA and DNA The Roles of RNA and DNA The cell uses the DNA “____________________” to prepare RNA “_______________________The DNA stays in the nucleus. The RNA molecules go to the protein ______________________sites in the cytoplasm—the ribosomes. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Genes and Proteins Genes and Proteins Genes contain ____________________ for assembling proteins. Many proteins are enzymes, which _______________________and regulate chemical reactions. Proteins are each specifically _______________ to build or operate a component of a living cell. Copyright Pearson Prentice Hall

Amino acids within a polypeptide Genes and Proteins Codon Codon Codon The sequence of bases in DNA is used as a ______________ for mRNA. The codons of mRNA specify the __________________of amino acids in a protein. Single strand of DNA Codon Codon Codon mRNA This diagram illustrates how information for specifying the traits of an organism is carried in DNA. The sequence of bases in DNA is used as a template for mRNA. The codons of mRNA specify the sequence of amino acids in a protein, and proteins play a key role in producing an organism’s traits. Alanine Arginine Leucine Amino acids within a polypeptide Copyright Pearson Prentice Hall