Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,

Slides:

Advertisements

Similar presentations

Protein Synthesis.

Advertisements

RNA and Protein Synthesis

Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.

12-3: RNA AND PROTEIN SYNTHESIS Biology 2. DNA double helix structure explains how DNA can be copied, but not how genes work GENES: sequence of DNA that.

Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

NOTES: Chapter 13 - RNA & Protein Synthesis

Transcription and Translation

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

VII RNA and Protein Synthesis

Protein Synthesis 12-3.

Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.

DNA to Proteins 3-4.

The Genetic Code.

CFE Higher Biology DNA and the Genome Translation.

SC.912.L.16.5 Protein Synthesis: Transcription and Translation.

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.

DNA Review  Contains the genetic instructions used in the development and functioning of all organisms  Found in the nucleus of cells!  Made.

RNA and Protein Synthesis

12-3 RNA and Protein Synthesis

Protein Synthesis The process of putting together amino acids to form proteins in the cell. The process of putting together amino acids to form proteins.

Protein Synthesis Part II. Translation. Review-What is the central dogma? The central dogma describes the flow of information from DNA to RNA to proteins.

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

RNA AND PROTEIN SYNTHESIS

RNA Another Nucleic Acid.

DNA Transcription & Protein Translation. DNA Transcription DNA must be copied to messenger RNA (mRNA) in the nucleus mRNA travels from nucleus to the.

Do Now: On the “Modeling DNA Transcription & Translation” handout, figure out the compimentary DNA sequence AND the mRNA sequence.

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?

RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.

RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

DNA -> RNA -> Proteins The basic language of all living things.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

RNA and Transcription. Genes Genes are coded DNA instructions that control the production of proteins within the cell To decode the genetic message, you.

RNA & Protein Synthesis

DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)

Notes: Transcription DNA vs. RNA

RNA and Protein Synthesis

Ribosomes and Protein Synthesis

Translation: RNA Protein

RNA Another Nucleic Acid.

Protein Synthesis.

Protein Synthesis.

RNA Another Nucleic Acid.

RNA Another Nucleic Acid.

RNA and Protein Synthesis

RNA and Protein Synthesis

Notes – Protein Synthesis: Translation

Transcription 8.4.

Old News TRANSCRIPTION: process that makes an _______ ___________ of DNA. RNA is ________________, and ___ is replaced by ___ (A-U; G-C) RNA___________________.

How DNA and RNA make Proteins.

Transcription & Translation.

Amino Acid Activation And Translation.

RNA and Protein Synthesis

Protein Synthesis.

Transcription and Translation

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

RNA: Structures and Functions

RNA and Protein Synthesis

Transcription/ Translation Notes 16-17

DNA -> RNA -> Proteins

RNA, Protein Synthesis, Transcription, and Translation

DNA Replication Living Environment 2015.

12-3 RNA & Protein Synthesis

The Production of Proteins by DNA

Presentation transcript:

Do Now:

 TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA, using bases complimentary to a DNA sequence.

 The mRNA copy of a gene leaves the nucleus, and heads to the ribosomes to be used.  Ribosomes build proteins by following the mRNA instructions

 Once the mRNA message leaves the nucleus, a ribosome will attach to it. Ribosome mRNA

 A codon is a 3- nucleotide sequence of mRNA that codes for a single amino acid.

 tRNA molecules have an anti-codon that is complimentary to the mRNA codon.  This is how amino acids get put together in the right order

 The ribosome attaches the new A.A. to a growing polypeptide chain.

 Stop codons code for a tRNA molecule that doesn’t carry any amino acids.  The new protein is released.

 After the stop codon is reached, the ribosome lets go of the mRNA. Both will be used again.  Most proteins are modified by other enzymes before they are ready to be used by the cell.

 With few exceptions, almost every cell uses the same genetic code.  This is one of the big pieces of evidence for a universal common ancestor to all living things.

 Translation makes proteins, using the instructions in an mRNA molecule.  A codon is 3 nucleotides that code for a single amino acid.  Ribosomes build the proteins from amino acids carried by tRNA molecules.  tRNA molecules “decode” the message into protein form by matching their anti-codons with the mRNA codons.  The universal genetic code can be used to figure out the sequence of amino acids in a protein from an mRNA sequence.