Genes on Chromosome 1 Breast cancer; 1p36Breast cancer; 1p36 Autosomal DeafnessAutosomal Deafness Susceptibility to Acute Leukemia; 1q21Susceptibility.

Slides:

Advertisements

Similar presentations

Allyson Clifford. Chromosome 12…. 143 million base pairs Contains between 1000 to 1300 genes between 4% and 4.5% of the total DNA in cells medium sized.

Advertisements

May, 12th 2007 Magistère of Biotechnologies, University of Orsay Pierre ABADIE INRA Bordeaux-Aquitaine, UMR Santé Végétale.

1 Chapter 41 Genetics of Neurodegenerative Diseases Copyright © 2012, American Society for Neurochemistry. Published by Elsevier Inc. All rights reserved.

Medical Mystery Patient X. Symptoms 0 Patient’s Symptoms: 0 Possible Diseases/Disorders: 0 Final Diagnosis:

Mutations. Definition mutation A mutation is a change in an organism’s DNA – Silent mutations are changes that do not result in a change to the organisms.

DNA marker analysis Mrs. Stewart Medical Interventions Central Magnet School.

Lecture 36: Cloning and Sequencing Genes. Lecture Outline, 12/5/05 Case Study: BRCA1, continued –Cloning DNA fragments into plasmids other vectors “Libraries”

Positional Cloning LOD Sib pairs Chromosome Region Association Study Genetics Genomics Physical Mapping/ Sequencing Candidate Gene Selection/ Polymorphism.

Introduction to Human Genetics. Facts Humans have 46 chromosomes or 23 pairs of chromosomes 2 types of chromosomes: –Autosomes: chromosomes that determine.

Genome Analysis Determine locus & sequence of all the organism’s genes More than 100 genomes have been analysed including humans in the Human Genome Project.

 Genes are found on the X AND Y chromosomes.  Genes that are carried on the sex chromosomes are called sex linked genes.

Section 18.4 Heredity Today’s Agenda The Basic Rules of Heredity Your Genes, Your Health Assignment in the computer lab. Slide 1 of 17.

Gene Mutations.

Genetic Testing. What is Genetic Testing? Analysis of human DNA, chromosomes and/or proteins Analysis of human DNA, chromosomes and/or proteins Used to:

Chromosome 10 Researched by: Ashley Thorne 136M base pairs 1305 total genes on chromosome AND…the entire chromosome has been sequenced since 2004!!

DNA Mutations Biology. What if we mess up one of the nucleotides and change one of the codons? We get a mutation! Mutations in DNA sequence: –Point mutations.

Let’s think about it… What are autosomes? What are sex chromosomes?

Heredity in Deafness Rachel Malinowski Christine Keogh Jon Bordogna Melissa Snyder.

Genetic Change G.Burgess Chromosomal Dissorders Nondisjunction Deletion Duplication Translocation Inversion Genetic Dissorders Point mutation Insertion.

Human Genome Biology Ch 14.

CASE #574321F – The Ford Family

Developmental & Genetic Diseases By Dr. Ghada Ahmed Lecturer of pathology Benha Faculty of Medicine.

Chromosome Mapping PowerPoint Alyssa Goodman Chromosome Two.

Chromosomes and Human Genetics Chapter 11. Karyotyping Separating chromosomes for an individual The human chromosomes have been karyotyped to see what.

Types of Mutations Graphic Organizer

Section 11.3 Genetic Changes.

Karyotype Notes. A karyotype is a “ picture ” of a person ’ s chromosomes. Each person has 46 chromosomes, in 23 pairs. Pairs 1-22 are called Autosomes.

Genetic Disorders – Gene Disorders. What is a gene? Gene – Sequence of DNA bases that code for a trait (blueprint)

Genetic disorders can be due to any of the following factors: A. Monogenetic Disorders: Caused by a mutation in a single gene 1. Autosomal recessive alleles:

What exactly is a mutated gene? Nope, that’s not it.

12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.

1 Finding disease genes: A challenge for Medicine, Mathematics and Computer Science Andrew Collins, Professor of Genetic Epidemiology and Bioinformatics.

A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA

Chromosomal Disorders

Warm Up for 12/1/15 You get ____ chromosomes from your mom and ___ chromosomes from your dad to give you a total of ____ chromosomes. Autosomes include.

Il “Dogma Centrale” della Biologia

Mutations Chapter 12-4.

Copyright Pearson Prentice Hall

Mutations Add to Table of Contents – p. 14

Relationship: ChromosomeGeneDNA

Section 18.4 Heredity Objectives

Mutations 12-4.

What makes a mutant?.

سرطان الثدي Breast Cancer

What does this protein make up or do?

What does this protein make up or do?

Mutations Notes.

Different mode and types of inheritance

what are autosomes? What are sex chromosomes?

Name of the disorder.

Name of the disorder.

Viruses and Cancer.

Sex Chromosomes.

Human Chromosomes.

Mutations And Genetic Disorders

Phenogenetic networks of genes linked to Alzheimer's and Parkinson's disease reveal concordant phenotypes Phenogenetic networks of genes linked to Alzheimer's.

Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.

Mutations Section 6.2.

A mutation is a change in an organism’s DNA.

Topic #3: Types of Mutations

Class Notes #8: Genetic Disorders

Unit 3 Notes: Cancer, Mutations, & Karyotyping.

Linkage, crossing over and chromosomal mapping (2).

Lesson 35 Mutations.

Single gene conditions (also called monogenic conditions) are caused by abnormalities, or mutations, of a single gene. These conditions can be severe or.

Presentation transcript:

Genes on Chromosome 1 Breast cancer; 1p36Breast cancer; 1p36 Autosomal DeafnessAutosomal Deafness Susceptibility to Acute Leukemia; 1q21Susceptibility to Acute Leukemia; 1q21 Cataracts; 1p36.13Cataracts; 1p36.13 Alzheimer's; 1q21 & 1q25Alzheimer's; 1q21 & 1q25 Parkinson Disease; 1p36Parkinson Disease; 1p36 Epilepsy; 1q21Epilepsy; 1q21

Base sequence of CYP4A11 1 gggtggtcag agagaggtag gggcactcag agatccagca ggtgctgcac catgagtgtc 61 tctgtgctga gccccagcag actcctgggt gatgtctctg gaatcctcca agcggcctcc 121 ctgctcattc tgcttctgct gctgatcaag gcagttcagc tctacctgca caggcagtgg 181 ctgctcaaag ccctccagca gttcccgtgc cctccctccc actggctctt cgggcacatc 241 caggagctcc aacaggacca ggagctacaa cggattcaga aatgggtgga gacattccca 301 agtgcctgtc ctcattggct atggggaggc aaagttcgtg tccagctcta tgaccctgac 361 tatatgaagg tgattctggg gagatcagac ccgaaatccc atggttccta cagattcctg 421 gctccatgga ttgggtacgg cttgctcctg ttgaatgggc agacatggtt ccagcatcga 481 cggatgctga ccccagcctt ccactatgac atcctgaagc cctatgtggg gctcatggca 541 gactctgtac gagtgatgct ggacaaatgg gaagagctcc ttggccagga ttcccctctg 601 gaggtctttc agcacgtctc cttgatgacc ctggacacca tcatgaagtg tgccttcagc 661 catcagggca gcatccaggt ggacaggaat tctcagtcct acatacaggc cattagtgac 721 ctgaacaacc tggttttttc ccgtgtgagg aatgcctttc accagaatga caccatctac 781 agcctgacct ctgctggccg ctggacacac cgcgcctgcc agctggccca tcagcacaca 841 gaccaagtga tccaactgag gaaggctcaa ctacagaagg agggggagct ggagaagatc 901 aagaggaaga ggcatttgga ttttctggat atcctcctct tggccaaaat ggagaatggg 961 agcatcttgt cagacaagga cctccgtgct gaggtggaca cgttcatgtt tgagggccac 1021 gacaccacag ccagtgggat ctcctggatc ctctatgctc tggccacaca ccccaagcat 1081 caggagaggt gccgggagga gatccacagc ctcctgggtg atggagcctc catcacctgg 1141 aaccacctgg accagatgcc ctacaccacc atgtgcatta aggaggcact gaggctctac 1201 ccaccggtgc caggcattgg cagagagctc agcactcccg tcaccttccc tgatgggcgc 1261 tccttgccca aaggtatcat ggtcctcctc tccatttatg gccttcacca caacccaaaa 1321 gtgtggccca acccagaggt gtttgaccct ttccgttttg caccgggttc tgctcaacac 1381 agccacgctt tcctgccctt ctcaggagga tcaaggaact gcatcgggaa acaatttgcc 1441 atgaacgagc tgaaggtggc cacggccctg accctgctcc gctttgagct gctgcctgat 1501 cccaccagga tccccatccc cattgcacga cttgtgttga aatccaaaaa tggaatccac 1561 ctgcgtctca ggaggctccc taacccttgt gaagacaagg accagctttg agggcctcca 1621 cctgccgtcc tgtcttcctg acccccgctt ctgtcccctt cctgtctgcc catatcctgt 1681 tttctgtctg cccaccttcc cttcttccca cctgcctgct gtcccccagt ctgcctgccc 1741 ttctctctct cacctttctc caggctccct acctgcttgt ctacctgtct cctacccacc 1801 tgtatctctt gttgggagaa aagctgagtg ttgggagaag ctgaggccga gcttgcatgt 1861 ctgacataat gtaaaagagt cttggatcat gtccaggatc cagggtctaa aaccccttgt 1921 ggcctttgga acaccaagct ctgtgctgaa gggtggaagg ctaccctgac gcaccataat 1981 ctaagcccgg ggcataaaac ccctcgtggc ttggatagaa tccagggctc gtggctctgg 2041 aatgtgtctg aacttgctgc ctcctcgctc cttgctctcc caggatcaat tgtatcttga 2101 gttaaaagaa cctgctctcc attatctcaa gtagcagagc agatgctaaa ccgtcacagc 2161 tgtaaatcat gtgcttaatg caacatgccc tttcgacccc cacattctca ccacctgttt 2221 ctttgtttga tcaccaataa ataatctgca cttccagagc tcggggcctt cacagcctcc 2281 atccttagct ttggcgccct ggacccactt tctctctcaa actgtctttt ctcactgctt 2341 tgactctgcc ggactttgtc acccccacga cctggtgttg ggtctgaaca ccccaacatc 2401 cctgaatctc cacccacctc ccaaactcct gcctgccctc cagactgtct gcccatacac 2461 ctgtctcctt cttcctgcct gcttgtctgt tcctatatta gtttcctatt actgctgtaa 2521 taaactatca caatctcagt gattttaaat aa (Cytochrome)

Linked Genes Epilepsy, Leukemia, Alzheimers (1q21) Epilepsy, Leukemia, Alzheimers (1q21) Breast Cancer, Parkinson Disease (1p36) Breast Cancer, Parkinson Disease (1p36) Known/Suspected Mutations: frequently deleted 1p36.3 regionfrequently deleted 1p36.3 region

263 million base pairs263 million base pairs Approx genes found on chromosome 1 Approx genes found on chromosome 1 Approx. 99% has been sequenced Approx. 99% has been sequenced