12-3 RNA and Protein Synthesis

Slides:



Advertisements
Similar presentations
12-3 RNA and Protein Synthesis
Advertisements

RNA and Protein Synthesis
RNA and Protein Synthesis
End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology Protein Synthesis: I will understand the general pathway of transcription and translation.
RNA and Protein Synthesis
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
RNA Transcription.
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
RNA & Protein Synthesis Intro Genes code DNA instructions that control the production of proteins within the cell. Genes The first step in decoding.
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology.
13.1 RNA.
RNA and Protein Synthesis
RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.
VII RNA and Protein Synthesis
End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis RNA and Protein Synthesis.
The Genetic Code.
12-3 RNA and Protein Synthesis
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Copyright Pearson Prentice Hall
Lesson Overview Lesson OverviewFermentation Lesson Overview 13.1 RNA.
RNA & Protein Synthesis
Nucleic Acids Comparing DNA and RNA. Both are made of nucleotides that contain  5-carbon sugar,  a phosphate group,  nitrogenous base.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
Gene Expression DNA, RNA, and Protein Synthesis. Gene Expression Genes contain messages that determine traits. The process of expressing those genes includes.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
End Show 12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 106. What are genes? They are coded.
 Genes are coded DNA instructions that will control the production of proteins  These messages have to change to RNA to be decoded.  RNA will give.
Chapter 13 From DNA to Proteins
Notes: Transcription DNA vs. RNA
RNA and Protein Synthesis
Lesson Overview 13.1 RNA.
RNA & Protein synthesis
Copyright Pearson Prentice Hall
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
From dna to rna.
Lesson Overview 13.1 RNA.
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
Lesson Overview 13.1 RNA Objectives: Contrast RNA and DNA.
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Copyright Pearson Prentice Hall
Lesson Overview 13.1 RNA
RNA & Protein synthesis
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Comparing RNA and DNA Each nucleotide in both DNA and RNA is made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base. There are three important.
I will understand the general pathway of transcription and translation
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
Lesson Overview 13.1 RNA.
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
RNA and Protein Synthesis
Genes and Protein Synthesis Review
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Lesson Overview 13.1 RNA.
Lesson: RNA Key Questions: How does RNA differ from DNA?
Lesson Overview 13.1 RNA.
Lesson Overview 13.1 RNA.
12-3: RNA and Protein Synthesis (part 1)
4a. Know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA.
Presentation transcript:

12-3 RNA and Protein Synthesis Copyright Pearson Prentice Hall

12–3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by copying part of the nucleotide sequence from DNA into RNA. RNA contains coded information for making proteins. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Structure of RNA The Structure of RNA Each nucleotide contains a 5-carbon sugar a phosphate group nitrogenous base. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Structure of RNA 3 main differences between RNA and DNA: The sugar in RNA is ribose instead of deoxyribose. RNA is generally single-stranded. RNA contains uracil in place of thymine. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA There are three main types of RNA: messenger RNA (mRNA) ribosomal RNA (rRNA) transfer RNA (tRNA) Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Messenger RNA (mRNA) carries copies of instructions for assembling amino acids into proteins. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA Ribosome Ribosomal RNA The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Ribosomal RNA is combined with proteins to form ribosomes. Ribosomes are made up of proteins and ribosomal RNA (rRNA). Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Types of RNA Amino acid The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Transfer RNA During protein construction, transfer RNA (tRNA) transfers each amino acid to the ribosome. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Transcription Transcription RNA molecules are produced by copying part of a nucleotide sequence of DNA into a complementary sequence in RNA. This process is called transcription. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Transcription RNA RNA polymerase DNA During transcription, RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall RNA Editing RNA Editing The DNA of eukaryotic genes contains sequences of nucleotides, called introns, that are not involved in coding for proteins. The DNA sequences that code for proteins are called exons. When RNA molecules are formed, introns and exons are copied from DNA. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall RNA Editing The introns are cut out of RNA molecules. The exons are then spliced together to form mRNA. Exon Intron DNA Pre-mRNA mRNA Many RNA molecules have sections, called introns, edited out of them before they become functional. The remaining pieces, called exons, are spliced together. Then, a cap and tail are added to form the final RNA molecule. Cap Tail Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code The Genetic Code The genetic code is the “language” of mRNA instructions. The code is written using four “letters” (the bases: A, U, C, and G). Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code A codon consists of three consecutive nucleotides on mRNA that specify a particular amino acid. A codon is a group of three nucleotides on messenger RNA that specify a particular amino acid. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code Each codon specifies a particular amino acid that is to be placed on the polypeptide chain. Some amino acids can be specified by more than one codon. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code The genetic code shows the amino acid to which each of the 64 possible codons corresponds. To decode a codon, start at the middle of the circle and move outward. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Genetic Code There is one codon AUG that can either specify the amino acid methionine or serve as a “start” codon for protein synthesis. There are three “stop” codons that do not code for any amino acid. These “stop” codons signify the end of a polypeptide. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Translation Translation is the decoding of an mRNA message into a polypeptide chain (protein). Translation takes place on ribosomes. During translation, the cell uses information from messenger RNA to produce proteins. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Messenger RNA is transcribed in the nucleus, and then enters the cytoplasm where it attaches to a ribosome. Nucleus During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Each tRNA molecule carries only one kind of amino acid. In addition to an amino acid, each tRNA molecule has three unpaired bases. These bases, called the anticodon, are complementary to one mRNA codon. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation The ribosome binds new tRNA molecules and amino acids as it moves along the mRNA. Lysine Phenylalanine tRNA Methionine Ribosome During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Start codon Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation Protein Synthesis Lysine tRNA During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Translation direction Ribosome Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Translation The process continues until the ribosome reaches a stop codon. Polypeptide Ribosome tRNA During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall The Roles of RNA and DNA The Roles of RNA and DNA The cell uses the DNA “master plan” to prepare RNA “blueprints.” The DNA stays in the nucleus. The RNA molecules go to the protein building sites in the cytoplasm—the ribosomes. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Genes and Proteins Genes and Proteins Genes contain instructions for assembling proteins. Many proteins are enzymes, which catalyze and regulate chemical reactions. Proteins are each specifically designed to build or operate a component of a living cell. Copyright Pearson Prentice Hall

END OF SECTION