Does Gene AT5G19490 Play a vital role in seed development?

Slides:



Advertisements
Similar presentations
Diagnosis with PCR This is a preparation of DNA. We zoomed in a portion of a gene. We know that two primers, Forward and Reverse, will hybridize at specific.
Advertisements

Arabidopsis thealiana AT3G56230 AT4G18650 What are the functions of them? Are they important for seed development? Spring 2004 Mariko Onozawa.
Mapping in Arabidopsis cont…
The Trihelix Transcription Factor Family Heather Hernandez.
Suppl Figure S1. mMDH genes in At and t-DNA mutant characterization. A) MDHs in Arabidopsis B) T-DNA insertions available At1g53240 mMDH1 At3g15020 mMDH2.
HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana
Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.
What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.
At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.
What Are the Methods and Approaches Used Study Knock-Out Mutations? Elaine Chiu Nancy Phang June 4, 2009.
The MYB and BHLH Transcription Factor Families by Elaine Chiu.
Arabidopsis Experiments
Gene Regulation: What it is, and how to detect it By Jordan, Jennifer, and Brian.
A Hypothesis for the function of gene AT4G23180 in A. thaliana By Nicole Foxworth and Deborah Lee (Ether Fowl Ox)
Using mutants to clone genes Objectives 1. What is positional cloning? 2.What is insertional tagging? 3.How can one confirm that the gene cloned is the.
F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.
HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.
Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.
Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem.
The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.
Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.
Fig. S1 Illustration of the fine-mapping evolution of cmr1 Arabidopsis mutant. F 2 mutant individuals were used for mapping. Molecular markers used in.
AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p Erf2p Swf1p Pfa5 Pfa3 GODZ HIP14 Pfa4 AtPAT10 TIP1 Akr1p1 Akr2p.
The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.
Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.
THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family
Daisy Robinton Matt Emmer Jason Chai
The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.
The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.
Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV.
Genetics & Genotyping By Kristin Gill & Daisy Robinton HC70AL Spring 2009.
Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.
Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.
Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.
NAC Family Genes AT1G01720 AT1G77450
Biotechnology.
Searching for the Genes that Control Seed Development
a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c
Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?
Emily Eder HC70AL - Spring 2005
Tandem Inserts, Phenotypic Segregation, Hypocotyl Length, and More…
Supplemental Figure 1 A) B) C)
Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.
Is AT2G23290 Important in Seed Development?
Welcome to the world of two Arabidopsis genes:
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
The Alfin-like PHD Zinc Finger Transcription Factor Family
The student is expected to: (6H) describe how techniques such as DNA fingerprinting, genetic modifications, and chromosomal analysis are used to study.
HC70AL Final Presentation
Put Your Dukes Up AT5G03220! Studying Embryo Lethality of
HC70AL Oral Presentation
What is AT5G03500? --Background and Structure--
Volume 14, Issue 5, Pages (March 2004)
At2G37120: A Gene Exploration
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
Rotation review Gaurav Moghe Genetics Program
Arabidopsis Transcription Factor Genes NF-YA1, 5, 6, and 9 Play Redundant Roles in Male Gametogenesis, Embryogenesis, and Seed Development  Jinye Mu,
HC70AL Research Presentation
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Plant Signaling: Notes from the Underground
Arabidopsis Thaliana Gene AT5G58610
Rodríguez-Milla Miguel A. , Salinas Julio   Molecular Plant 
Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.
Jaimie M. Van Norman, Rebecca L. Frederick, Leslie E. Sieburth 
The Nuclear dsRNA Binding Protein HYL1 Is Required for MicroRNA Accumulation and Plant Development, but Not Posttranscriptional Transgene Silencing  Franck.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Arabidopsis RPA2: A Genetic Link among Transcriptional Gene Silencing, DNA Repair, and DNA Replication  Taline Elmayan, Florence Proux, Hervé Vaucheret 
Presentation transcript:

Does Gene AT5G19490 Play a vital role in seed development? Research Presentation By Ben Torres HC70AL Spring 2004 AT5G19490                             FW >>> RV <<<< 1 1073bp

Did Molecular biology techniques facilitate our quest for knowledge? FW+Jl202 How can we unambiguously tell if there is a T-DNA insert in Gene AT5G19490? RV+Jl202 AT5G19490 Why didn’t the experiment end by picking the super pool with fragments smaller than the gene AT5G19490 on the gel?

What did the AutoRadiograph reveal How was the size of the fragments known? AT5G19490 900bp fragment Did this show unambiguously the smaller fragment was a T-DNA insert?

What do you do When all else fails? cDNA of ortholog gene ATG19490 in the scarlet runner bean SIGnAL "T-DNA Express" Arabidopsis Gene Mapping Tool

Why not do conduct a microarray on the arabidopsis itself? Key for corresponding Stages of plant life On the X axis. 1=wild type ovules 2=wild type 24-hour seeds 3=wild type mid-maturation (Cotyledon stage) 4=wild type mature green seeds 5=wild type post maturation green seeds 6=wild type seedlings (3DAI) 7=wild type leaves 8=wild type roots 9=wild type stem 10=wild type C24 leaves

What about the Salk lines Possible T-DNA homozygous Salk lines Does this show the full genotype? Wild type PCR conducted on salk lines How did the rest of the Genotyping go?

What about the Madison DNA pools PossibleT-DNA insert

What next? Genotype Salk lines using the FW primer ant the LBb1 T-DNA primer correctly to unambiguously define the genotypes Try to obtain a correct sequence from the DNA pool containing the fragment size of interest.