The Alfin-like PHD Zinc Finger Transcription Factor Family

Slides:



Advertisements
Similar presentations
Mendel’s Laws.
Advertisements

Diagnosis with PCR This is a preparation of DNA. We zoomed in a portion of a gene. We know that two primers, Forward and Reverse, will hybridize at specific.
T-DNA Mutagenesis T-DNA Mutagenesis. Transfer-DNA Mutagenesis: a chemical or physical treatment that creates changes in DNA sequence which can lead to.
Arabidopsis thealiana AT3G56230 AT4G18650 What are the functions of them? Are they important for seed development? Spring 2004 Mariko Onozawa.
Determining the roles of the BTB genes At2g04740, At4g08455, At1g04390, and At2g30600 in Arabidopsis thaliana growth and development. Brandon D. Blaisdell,
The Trihelix Transcription Factor Family Heather Hernandez.
HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana
Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.
What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.
At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.
HC70AL Spring 2009 An Introduction to Bioinformatics By Brandon Le & Min Chen April 7, 2009.
The MYB and BHLH Transcription Factor Families by Elaine Chiu.
Mutations in Arabidopsis Exocyst Gene AtSEC8 Jennie Hines Mentor: John Fowler.
A Hypothesis for the function of gene AT4G23180 in A. thaliana By Nicole Foxworth and Deborah Lee (Ether Fowl Ox)
Arabidopsis: The Model Organism Melissa Borkenhagen Heather Hernandez.
F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.
HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.
Review Questions Genetics.
Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.
The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.
Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.
Figure S1. Alignment of identified AtMYB93/92/53 homologues in land plants, used to infer the phylogeny in Figure 1B. Supporting information Figs S1-S7.
Mendel: Fundamentals of Genetics
The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.
Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.
THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family
Daisy Robinton Matt Emmer Jason Chai
The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.
The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.
Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV.
Genetics & Genotyping By Kristin Gill & Daisy Robinton HC70AL Spring 2009.
Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.
Searching for Genes Important in Seed Development At1g19000 At1g74840 BY: Mike Douglas.
Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.
Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.
NAC Family Genes AT1G01720 AT1G77450
Searching for the Genes that Control Seed Development
a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c
Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?
Emily Eder HC70AL - Spring 2005
Tandem Inserts, Phenotypic Segregation, Hypocotyl Length, and More…
Is AT2G23290 Important in Seed Development?
Intro to Genetics.
Welcome to the world of two Arabidopsis genes:
Does Gene AT5G19490 Play a vital role in seed development?
HC70AL Final Presentation
Put Your Dukes Up AT5G03220! Studying Embryo Lethality of
February 7, 2016 Journal: Why do you and your siblings have different traits even though you have the same parents?
HC70AL Oral Presentation
Unit 5 “Mendelian Genetics”
What is AT5G03500? --Background and Structure--
Arabidopsis: The Model Organism
At2G37120: A Gene Exploration
Volume 10, Issue 3, Pages (March 2017)
Unit 5 “Mendelian Genetics”
Arabidopsis Transcription Factor Genes NF-YA1, 5, 6, and 9 Play Redundant Roles in Male Gametogenesis, Embryogenesis, and Seed Development  Jinye Mu,
HC70AL Research Presentation
Genetics.
Heat Shock Factor Protein Family of Transcription Factors
Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2
Molecular cloning of pms916 salt hypersensitive T-DNA mutant.
Quick genetics review.
Intro to Genetics.
Arabidopsis Thaliana Gene AT5G58610
Volume 7, Issue 1, Pages (January 2014)
Volume 8, Issue 2, Pages (February 2015)
Rodríguez-Milla Miguel A. , Salinas Julio   Molecular Plant 
Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.
Posttranscriptional Gene Silencing Is Not Compromised in the Arabidopsis CARPEL FACTORY (DICER-LIKE1) Mutant, a Homolog of Dicer-1 from Drosophila  E.Jean.
Volume 5, Issue 6, Pages (November 2012)
Presentation transcript:

The Alfin-like PHD Zinc Finger Transcription Factor Family in Arabidopsis Thaliana Melissa Borkenhagen 8 May 2006 HC70AL DR. Bob Goldberg

Gene AT5G20510 T-DNA 5’ UTR EXON 3’ UTR INTRON Chromosome 5 LBb1 FW T-DNA INSERT ACCORDING TO SALK Chromosome 5

Gene AT3G42790 T-DNA 5’ UTR EXON 3’ UTR INTRON Chromosome 3 LBb1 FW T-DNA INSERT ACCORDING TO SALK Chromosome 3

In which plant organs are the genes active? Gene AT5G20510 Gene AT3G42790 Consistent with GeneChip Data, both genes appear to be active in these plant organs.

Gene AT5G20510 Plant Genotypes Separation of primers Only one T-DNA Insert Plant 1 is the only Homozygous Mutant Plant Strange double bands What are the genotypes?

Gene AT3G42790 Plant Genotypes Plants 1 and 4 are Homozygous Mutants Plant 5: Heterozygous?

Are there any observable phenotypic differences between wild type and mutant plants? No significant differences observed between wild type and mutant plants.

Is continued work on this family of transcription factors important? Research has shown that members of the alfin-like PHD zinc finger transcription factor family may be influential in plant development. Some appear to be particularly influential during seed development, with a possible role in the differential seedling development in darkness and light. Thus, continued work on these proteins is important!