DNA – life’s code DNA = Molecule that makes up genes and determines the traits of all living things

Griffith’s Mouse Experiment Fredrick Griffith

Frederick Griffith Mixing together different strains of bacteria allowed substances (DNA) to mix. Something has to exist to transfer \ information from one bacteria type to a different type. That something is DNA!!

http://www.wwnorton.com/college/biology/discoverbio3/full/content/index/animations.asp

Purified different bacteria parts and injected these into mice. Avery, MacLeod, and McCarty Purified different bacteria parts and injected these into mice. Determined that DNA was the genetic material responsible for Griffith’s results (not RNA). Peter J. Russell, iGenetics: Copyright © Pearson Education, Inc., publishing as Benjamin Cummings.

Hershey-Chase Experiment Section 12-1 Virus injects DNA not proteins. DNA is the genetic information NOT proteins. Bacteriophage with phosphorus-32 in DNA Phage infects bacterium Radioactivity inside bacterium http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120076/bio21.swf::Hershey%20and%20Chase%20Experiment Bacteriophage with sulfur-35 in protein coat Phage infects bacterium No radioactivity inside bacterium

Hershey-Chase Bacteriophage Experiment - 1953 Bacteriophage = Virus that attacks bacteria and replicates by invading a living cell and using the cell’s molecular machinery. Structure of T2 phage Bacteriophages are composed of DNA & protein

Life cycle of virulent T2 phage:

Rosalind Franklin Thought DNA had a double helix shape/structure. RNA helps to make proteins

Structure of DNA James D. Watson/Francis H. Crick 1953 proposed the Double Helix Model based on two sources of information: 1. Photograph of Franklin’s work. 2. Learning Base Pairing Rules. Conclusion-DNA is a helical structure

Importance of DNA Controls by: producing proteins Proteins are important because All structures are made of protein Skin Muscles Bones All actions depend on enzymes (special kind of protein) Eating Running Thinking All life activities DNA contains the complete instructions for making all proteins

DNA Structure Stands for deoxyribonucleic acid Double helix = twisted ladder linked nucleotides

DNA Structure - nucleotide Made of 3 things: Deoxyribose (sugar) Phosphate Group Nitrogen bases

DNA Structure – nitrogen bases Four types of Nitrogen Bases: Adenine Cytosine Guanine Thymine A nucleotide is named for the nitrogen base it contains

Linking Nucleotides Nucleotides join together to make DNA – complementary base pairing Adenine fits with Thymine A – T Cytosine fits with Guanine C – G

Base Pairing Base Pairing = nucleotides in a base pair are complementary which means their shape allows them to bond together with hydrogen bonds. Adenine (A) bonds with Thymine (T) Cytosine (C) bonds with Guanine (G)

Base Pairs Base Pairs consist of a Purine and a Pyrimidine bonded together. Purine = 2 carbon rings Adenine (A) Guanine (G) Pyrimidine = 1 carbon ring Thymine (T) Cytosine (C )

Interest Grabber A Perfect Copy When a cell divides, each daughter cell receives a complete set of chromosomes. This means that each new cell has a complete set of the DNA code. Before a cell can divide, the DNA must be copied so that there are two sets ready to be distributed to the new cells. Go to Section:

Interest Grabber continued 1. On a sheet of paper, draw a curving or zig-zagging line that divides the paper into two halves. Vary the bends in the line as you draw it. Without tracing, copy the line on a second sheet of paper. 2. Hold the papers side by side, and compare the lines. Do they look the same? 3. Now, stack the papers, one on top of the other, and hold the papers up to the light. Are the lines the same? 4. How could you use the original paper to draw exact copies of the line without tracing it? 5. Why is it important that the copies of DNA that are given to new daughter cells be exact copies of the original? Go to Section:

DNA Replication DNA replication is the process of producing two identical replicas from one original DNA molecule. All living things replicate their DNA Happens in Interphase before Mitosis and Meiosis

DNA Replication Making a chromosome copy One strand  two identical strands Each new double helix is consisted of one old and one new chain. This is what we call semiconservative replication.

DNA Polymerase DNA Polymerase: In charge of copying DNA and finding matching bases to pair with the original strand DNA must be faithfully replicated…but mistakes occur DNA polymerase (DNA pol) inserts the wrong nucleotide base in 1/10,000 bases DNA pol has a proofreading capability and can correct errors

Steps of DNA Replication 1). Breaking of hydrogen bonds between bases of the two DNA strands. 2). DNA unwinds The splitting happens in places of the chains which are rich in A-T. Helicase is the enzyme that splits the two strands. Creates a "Replication Fork".

Steps of Replication 3). DNA Polymerase binds to the starting site 4). DNA Polymerase can "read" the template and continuously adds complementary nucleotides 5). Elongation Process 6). DNA Polymerase reaches to an end of the strands and detaches . 7). Error Check: Enzymes remove the wrong nucleotides and the DNA Polymerase fills the gaps.

Figure 12–11 DNA Replication Section 12-2 Original strand DNA polymerase New strand Growth DNA polymerase Growth Replication fork Replication fork Nitrogenous bases New strand Original strand Go to Section:

Animation Links DNA replication http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/dna-rna2.swf http://www.wwnorton.com/college/biology/discoverbio3/full/content/ch12/animations.asp http://www.youtube.com/watch?v=zdDkiRw1PdU&feature=related

DNA Replication Review The process of DNA Replication is NOT used to make proteins Only used to make more DNA so cells can divide.

RNA vs. DNA Review Similarities: DNA & RNA Differences: DNA & RNA

Protein Synthesis = Make Proteins DNA Replication is NOT part of protein synthesis Two steps: Transcription: taking your DNA (genes) and making it into messenger RNA (mRNA). Translation: turning messenger RNA (mRNA) into proteins proteins make up cells.

Protein Synthesis: Flow Chart 1. Transcription 2. Translation

1. Transcription Takes place in the nucleus. mRNA results from the process of transcription Takes DNA and makes mRNA. mRNA can leave the nucleus.

TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGG ACU

Major players in transcription mRNA- type of RNA that encodes information for the synthesis of proteins and carries information to ribosome from the nucleus

Major players in transcription RNA polymerase- complex enzymes with 2 functions: Unwind DNA sequence Produce mRNA transcript by stringing together the chain of RNA nucleotides

Transcription Steps 1. RNA polymerase bind to a DNA molecule. 2. The DNA is unwound to separate and expose the strand to be transcribed. 3. RNA Polymerase begins to synthesize a strand of RNA complementary to one side of the DNA strand, moving into the coding sequence portion of the gene being transcribed. 4. A RNA molecule is produced by DNA polymerase as it reads the DNA code.

Transcription 5). RNA polymerase encounters a particular DNA sequence, telling it to stop. 6). RNA polymerase disengages from the DNA and the RNA molecule is released for processing. Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) DNA RNA

mRNA Processing The newly made transcript is not functional mRNA DNA sequence has coding regions (exons) and non-coding regions (introns) Introns must be removed before the transcript is mRNA and can leave nucleus

Transcription http://www.youtube.com/watch?v=OtYz_3rkvPk Section 12-3 http://www.youtube.com/watch?v=OtYz_3rkvPk Transcription Animation

Transcription is done…what now? Now we have functional mRNA transcribed from the cell’s DNA. mRNA leaves the nucleus. Once in the cytoplasm, it finds a ribosome so that translation can begin. Question: We know how mRNA is made, but how do we “read” the code?

Translation Second stage of protein production mRNA is on a ribosome

Translation tRNA brings amino acids to the ribosome

Translation Translation is the synthesis of a polypeptide (PROTEIN) TRANSCRIPTION TRANSLATION DNA mRNA Ribosome Polypeptide Amino acids tRNA with amino acid attached tRNA Anticodon Trp Phe Gly A G C U Codons 5 3 Translation is the synthesis of a polypeptide (PROTEIN) Translation involves mRNA Ribosomes - Ribosomal RNA Transfer RNA Genetic coding - codons

Reading the DNA code Every 3 DNA bases pairs with 3 mRNA bases Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet (3) of mRNA bases

tRNA Transfer RNA Bound to one amino acid on one end Anticodon on the other end matches mRNA codon

tRNA Function Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code

Translation 1. The ribosome binds to mRNA at a specific area. 2. The ribosome starts matching tRNA anticodon sequences to the mRNA codon sequence. 3. Each time a new tRNA comes into the ribosome, the amino acid that it was carrying gets added to the elongating polypeptide chain.

Translation mRNA : Nucleus Messenger RNA mRNA Lysine Phenylalanine Messenger RNA is transcribed in the nucleus. mRNA Lysine Phenylalanine tRNA Transfer RNA The mRNA then enters the cytoplasm and attaches to a ribosome. Translation begins at AUG, the start codon. Each transfer RNA has an anticodon whose bases are complementary to a codon on the mRNA strand. The ribosome positions the start codon to attract its anticodon, which is part of the tRNA that binds methionine. The ribosome also binds the next codon and its anticodon. Methionine Ribosome mRNA Start codon :

Translation (continued) The Polypeptide “Assembly Line” The ribosome joins the two amino acids—methionine and phenylalanine—and breaks the bond between methionine and its tRNA. The tRNA floats away, allowing the ribosome to bind to another tRNA. The ribosome moves along the mRNA, binding new tRNA molecules and amino acids. Growing polypeptide chain Ribosome tRNA Lysine tRNA mRNA Completing the Polypeptide The process continues until the ribosome reaches one of the three stop codons. The result is a growing polypeptide chain. mRNA Translation direction Ribosome

The Genetic Code Section 12-3 :

Translation Translation Occurs in the cytoplasm Occurs on ribosomes mRNA -> Protein http://www.youtube.com/watch?v=B6O6uRb1D38 Translation

DNA Splits In nucleus “Unzipping” Transcription DNA Splits In nucleus “Unzipping” Messenger RNA (mRNA) copies DNA and DNA reforms ladder Translation Travels to ribosome Transfer RNA (tRNA) copy mRNA and make proteins

Transcription vs. Translation Review Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein

Gene Mutations: Section 12-4 Substitution Insertion Deletion Point mutation- mutations that affect one nucleotide; generally change one amino acid in a protein (ex: substitution) Less Severe Frameshift mutations (Insertion and Deletion) cause much bigger changes since the sequence is read in 3 base codons, everything is now moved over one spot More Severe Mutations Can change the entire protein. Go to Section:

Typical Gene Structure Section 12-5 Promoter (RNA polymerase binding site) Regulatory sites DNA strand Start transcription Stop transcription At first glance- a DNA sequence is a bunch of jumbled letters, but soon patterns emerge. Some sequences serve as promoters: binding sites for RNA polymerase Some sequences are stop and start signals for transcription Regulatory Sites: places where other proteins, binding directly to the DNA at that site, can regulate transcription. These help determine if a gene will be turned on or off A typical gene includes start and stop signals, with the nucleotides to be translated in between Go to Section: