Presentation is loading. Please wait.

Presentation is loading. Please wait.

Transcription and Translation

Published byAndreas Andersen Modified over 4 years ago

Similar presentations

Presentation on theme: "Transcription and Translation"— Presentation transcript:

1 Transcription and Translation

2 Protein Structure Made up of amino acids
Polypeptide- string of amino acids 20 amino acids are arranged in different orders to make a variety of proteins Assembled on a ribosome

3 Replication DNA double helix unwinds DNA now single-stranded
New DNA strand forms using complementary base pairing (A-T, C-G) Used to prepare DNA for cell division Whole genome copied/replicated

4 Transcription and Translation: An Overview (aka the Central Dogma)

5 RNA vs. DNA DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA
Single stranded Ribose sugar Bases: C,G,A,U Both contain a sugar, phosphate, and base.

6 Transcription RNA forms base pairs with DNA C-G A-U

7 TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGG ACU

8 Major players in transcription
mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

9 Major players in transcription
RNA polymerase- complex of enzymes with 2 functions: Unwind DNA sequence Produce primary transcript by stringing together the chain of RNA nucleotides

10 mRNA Processing DNA sequence has coding regions (exons) and non-coding regions (introns) Introns must be removed before primary transcript is mRNA and can leave nucleus

11 Transcription is done…what now?
Now we have mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin.

12 Translation Second stage of protein production mRNA is on a ribosome

13 Ribosomes 2 subunits, separate in cytoplasm until they join to begin translation Large Small

14 Translation Second stage of protein production mRNA is on a ribosome
tRNA brings amino acids to the ribosome

15 tRNA Transfer RNA Bound to one amino acid on one end
Anticodon on the other end complements mRNA codon

16 tRNA Function Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code

17 Reading the DNA code Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA bases

18 Transcription vs. Translation Review
Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein

Download ppt "Transcription and Translation"

Similar presentations

Transcription and Translation

Transcription and Translation
13.3: RNA and Gene Expression

13.3: RNA and Gene Expression
DNA Biology Lab 11. Nucleic Acids  DNA and RNA both built of nucleotides containing Sugar (deoxyribose or ribose) Nitrogenous base (ATCG or AUCG) Phosphate.

DNA Biology Lab 11. Nucleic Acids  DNA and RNA both built of nucleotides containing Sugar (deoxyribose or ribose) Nitrogenous base (ATCG or AUCG) Phosphate.
1. RNA vs. DNA RNADNA TThe sugar is RIBOSE UURACIL (U) is substituted for (T) Thymine AA=U CC=G RRNA is a single stranded chain of nucleotides.

1. RNA vs. DNA RNADNA TThe sugar is RIBOSE UURACIL (U) is substituted for (T) Thymine AA=U CC=G RRNA is a single stranded chain of nucleotides.
TTAAGCGCTAATCGTACT Agenda Bell work #30

TTAAGCGCTAATCGTACT Agenda Bell work #30
RNA & Protein Synthesis.

RNA & Protein Synthesis.
Protein Synthesis 6C transcription & translation.

Protein Synthesis 6C transcription & translation.
Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.
RNA and Protein Synthesis

RNA and Protein Synthesis
3 types:  mRNA – used in transcription  tRNA – used in translation  rRNA – makes up ribosomes Composed of nucleotides  5 carbon sugar = ribose  phosphate.

3 types:  mRNA – used in transcription  tRNA – used in translation  rRNA – makes up ribosomes Composed of nucleotides  5 carbon sugar = ribose  phosphate.
12-3 RNA and Protein Synthesis

12-3 RNA and Protein Synthesis
T RANSCRIPTION & T RANSLATION. C ENTRAL D OGMA Information flows in one direction from DNA to RNA to proteins. This is known as the central dogma.

T RANSCRIPTION & T RANSLATION. C ENTRAL D OGMA Information flows in one direction from DNA to RNA to proteins. This is known as the central dogma.
Transcription and Translation. Protein Structure  Made up of amino acids  Polypeptide- string of amino acids bonded together (peptide bonds) Enzymes.

Transcription and Translation. Protein Structure  Made up of amino acids  Polypeptide- string of amino acids bonded together (peptide bonds) Enzymes.
Structure of DNA DNA is made up of a long chain of nucleotides

Structure of DNA DNA is made up of a long chain of nucleotides
DAY 1. Journal Questions A question given to you every few days To be checked on Tuesdays during Eagle time – Mrs. Nedrow and Mrs. Mahan’s class go to.

DAY 1. Journal Questions A question given to you every few days To be checked on Tuesdays during Eagle time – Mrs. Nedrow and Mrs. Mahan’s class go to.
Transcription and Translation. Central Dogma of Molecular Biology  The flow of information in the cell starts at DNA, which replicates to form more DNA.

Transcription and Translation. Central Dogma of Molecular Biology  The flow of information in the cell starts at DNA, which replicates to form more DNA.
Transcription, Translation & Protein Synthesis Do you remember what proteins are made of ?  Hundreds of Amino Acids link  together to make one Protein.

Transcription, Translation & Protein Synthesis Do you remember what proteins are made of ?  Hundreds of Amino Acids link  together to make one Protein.
DAY 2. Warm Up What type of RNA copies DNA? – mRNA What is this process called? – Transcription.

DAY 2. Warm Up What type of RNA copies DNA? – mRNA What is this process called? – Transcription.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
Unit 3.1 – Protein Synthesis. DAY 1 Journaling Question: Why is the gene that gives your freckles in your skin, not expressed in your pancreas?

Unit 3.1 – Protein Synthesis. DAY 1 Journaling Question: Why is the gene that gives your freckles in your skin, not expressed in your pancreas?

Similar presentations

Ads by Google