1. DNA song http://www.youtube.com/watch?v=wdhL-T6tQco

2. CHAPTER 12 :NUCLEIC ACIDS
DNA, RNA,
and Protein Synthesis

3. DNA is a code for making proteins.
DNA  RNA  Protein  Traits

4. Nucleic Acids- DNA and RNA
Monomers are nucleotides
contain C, H, O, N, and P

5. 2 Types of Nucleic Acids DNA Deoxyribonucleic Acid
RNA Ribonucleic Acid

6. DNA Functions 1. Genetic code 2. Replication- make copies of itself
(stores code for making proteins)
2. Replication- make copies of itself
(Interphase of the cell cycle)

7. Watson and Crick (1953) first model of DNA Described as:
Double Helix (Double Stranded) like a twisted ladder

8. Rosalind Franklin
Photographed DNA using a technique called X-ray diffraction.

9. DNA Nucleotides Each nucleotide consists of: 1. Phosphate group
2. Deoxyribose
3. One of four nitrogen bases - Adenine (A)
Guanine (G)
Cytosine (C)
Thymine (T)

10. DNA Nitrogen Bases
Purines: double ring of carbon Adenine (A) Guanine (G)
Pyrimidines: single
ring of carbon
Thymine (T)
Cytosine (C)

11. Base Pair Rule (COMPLEMENTARY BASE PAIRING)
A bonds to T: DOUBLE Hydrogen Bond
C bonds to G: TRIPLE Hydrogen Bond
Triple bond
Double bond

13. Let’s Practice Building DNA!

14. Practice

15. Replicated Chromosome Parts
centromere
2 chromatids

16. Chromosomes are many genes linked together.
They coil up for cell division.

17. A gene is a section of DNA that codes for one protein.
switch gene

18. DNA Replication
Before cell division, cells copy (replicate) their DNA during interphase
Each new DNA strand now has 1 complete original strand and 1 new strand

19. DNA Replication unzips (breaks H bonds) DNA at the replication fork.
DNA HELICASE
unzips (breaks H bonds) DNA at the replication fork.

20. DNA Replication Con’t
New DNA nucleotides are matched and attached to each side of the DNA using DNA POLYMERASE Result: Two new DNA molecules contain one original (parent) strand and one new strand

21. DNA polymerase moves along strand helping bond new DNA nucleotides to the original DNA strands

22. Proofreading
Speed of DNA replication: 3,000 nucleotides/min in human ,000 nucleotides/min in E.coli
Accuracy of DNA replication: Very precise(1 error/1,000,000,000 nt)

24. DNA Replication

25. Let’s Practice DNA Replication!

26. RNA: Ribonucleic Acid Formed in the nucleus SINGLE STRANDED
Creates proteins for the cell
Made of RNA nucleotides:
* 5 C Sugar -Ribose
* Phosphate group
* One of four nitrogen bases: A,G, C,
U (Uracil)

27. RNA Bases Adenine (A) Guanine (G) Cytosine (C) Uracil (U)
Thymine (T) is not found in RNA but is replaced by Uracil (U)

28. RNA Base Pairing
DNA
RNA A U C G T

29. 3 Types of RNA * carries the “Code” for protein building
1. m-RNA: messenger RNA.
* carries the “Code” for protein building
from DNA to a ribosome. Ribbon shaped.
2. t-RNA: transfer RNA: 20 different t-RNA exist
* special shape allows it to transport a specific
amino acid to a ribosome to help build a protein
3. r-RNA: ribosomal RNA. Makes up a ribosome.

31. Protein Synthesis Overview
STEPS-
1. TRANSCRIPTION- code from DNA is copied onto RNA
2. TRANSLATION- AMINO ACIDS are linked together to make protein using RNA.

32. Transcription – Makes mRNA
In the NUCLEUS RNA POLYMERASE:
1. Unzips the DNA
2. Reads the DNA and attaches RNA nucleotides that complement the DNA bases
(Only one side of DNA will be used as a template)
* Result: RNA (mRNA) breaks off from DNA and goes to the cytoplasm
3) Reattaches the two DNA strands.

33. Shape of m-RNA
1. Ribbon-like
2. Codons: 3 consecutive nucleotides.

34. Transcription

35. Overview of Translation
mRNA is ‘read’ by the ribosome using codons (3 nucleotides in a row)
Transfer RNA (tRNA) anticodon matches up with the m-RNA codon to create a protein

36. Translation – the making of a protein
mRNA attaches to a ribosome (made of rRNA and protein)
Each m-RNA codon will code for an amino acid
Order of the amino acids determine the protein which is formed

37. Amino acids are determined by the order of the letters in the codon
There are 64 possible 3-letter combinations
These code for 20 different amino acids (each amino acid has several 3-letter combinations which can code for it)

39. Ribosomes: Site of P.S.
t-RNA brings the correct amino acid to the ribosome by matching its anticodon to mRNA’s codon
Amino acids bond together by a peptide bond to make a protein

40. CODON TABLE

41. Shape of t-RNA Amino Acid
Anticodons are 3 consecutive nucleotides that
complement m-RNA’s codons.

42. Beginning of Translation

43. Translation

44. Termination of Translation

45. Termination of Translation

46. DNA transcription mRNA translation Protein

47. (Amino acid)

48. Warm-up Use the following DNA and determine the m-RNA
codon and the t-RNA codon sequences.
TACGGGCAGCGCTTTAAAATTGCCG
List the first step of protein synthesis. Identify where in the cell it happens and what the final product is.
List the second step of protein synthesis. Identify where in the cell it happens and what the final product is.

50. Protein Shape The expression of a trait: gene  protein trait
Amino Acid Sequence determines the SHAPE and FUNCTION of a protein.
The expression of a trait:
gene  protein trait

51. Let’s Practice Protein Synthesis!