Biotechnology 2007-2008

A Brave New World

human genome 3.2 billion bases TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT human genome 3.2 billion bases

*The code is universal Since all living organisms… use the same DNA use the same code book read their genes the same way Strong evidence for a single origin in evolutionary theory.

Biotechnology today Genetic Engineering Our tool kit… manipulation of DNA if you are going to engineer DNA & genes & organisms, then you need a set of tools to work with this unit is a survey of those tools… Our tool kit…

Plasmids Small supplemental circles of DNA carry extra genes 5000 - 20,000 base pairs self-replicating carry extra genes 2-30 genes genes for antibiotic resistance can be exchanged between bacteria remember conjugation? rapid evolution can be imported from environment Mini-chromosomes

How can plasmids help us? A way to get genes into bacteria easily insert new gene into plasmid insert plasmid into bacteria = vector bacteria now expresses new gene bacteria make new protein transformed bacteria gene from other organism recombinant plasmid vector plasmid cut DNA + glue DNA

insert “gene we want” into plasmid... “glue” together Biotechnology Plasmids used to insert new genes into bacteria cut DNA gene we want like what? …insulin …hGH …lactase cut plasmid DNA Cut DNA? DNA scissors? ligase insert “gene we want” into plasmid... “glue” together recombinant plasmid

What is a Restriction Enzyme? Restriction Enzymes recognize specific DNA sequences and cut the DNA Restriction Enzymes can be thought of as molecular scissors

chromosome want to add gene to Sticky ends Cut two strands of DNA with same enzymes leave “sticky ends” on both can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA

How Restriction Enzymes Are Used

How do we cut DNA?(review) Restriction enzymes restriction endonucleases discovered in 1960s evolved in bacteria to cut up foreign DNA “restrict” the action of the attacking organism protection against viruses & other bacteria 

Engineered plasmids Building custom plasmids restriction enzyme sites antibiotic resistance genes as a selectable marker EcoRI BamHI HindIII 2.restriction sites Selectable marker antibiotic resistance gene on plasmid ampicillin resistance selecting for successful transformation successful uptake of recombinant plasmid How do we know what’s the right combination of genes on a plasmid? Trail and error research work. selectable markers high copy rate convenient restriction sites There are companies that still develop plasmids, patent them & sell them. Biotech companies (ex. New England BioLabs) plasmid 1.ori 3.amp resistance

Selection for plasmid uptake Antibiotic becomes a selecting agent only bacteria with the plasmid will grow on antibiotic (ampicillin) plate only transformed bacteria grow all bacteria grow a a a a a a a a a a a a a a a a a LB plate LB/amp plate cloning

Concept 13.2 DNA Can Genetically Transform Cells and Organisms Selectable markers are a type of reporter gene—a gene for which expression is easily observed. Two other common reporter genes: β-galactosidase (lacZ) gene codes for an enzyme that converts a white substrate into bright blue. Cloning plasmids may contain antibiotic resistance genes and the lacZ gene.

Concept 13.2 DNA Can Genetically Transform Cells and Organisms Green fluorescent protein (GFP) from a jellyfish emits green light when exposed to UV light. The gene for this protein is widely used as a reporter gene.

How can bacteria read human DNA? human insulin gene in bacteria Why mix genes together? Recombinant DNA: a DNA molecule made in the laboratory that is derived from two or more sources human insulin gene in bacteria TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC aa “new” protein from organism ex: human insulin from bacteria bacteria human insulin

Bacteria Bacteria review one-celled prokaryotes reproduce by mitosis binary fission rapid growth generation every ~20 minutes 108 (100 million) colony overnight! dominant form of life on Earth incredibly diverse

Transformation Bacteria are opportunists promiscuous!? Bacteria are opportunists pick up naked foreign DNA wherever it may be hanging out have surface transport proteins that are specialized for the uptake of naked DNA import bits of chromosomes from other bacteria incorporate the DNA bits into their own chromosome express new genes transformation form of recombination mix heat-killed pathogenic & non-pathogenic bacteria While E. coli lacks this specialized mechanism, it can be induced to take up small pieces of DNA if cultured in a medium with a relatively high concentration of calcium ions. In biotechnology, this technique has been used to introduce foreign DNA into E. coli. mice die

Methods for inserting recombinant DNA into a cell: Cells are treated with chemicals to make plasma membranes more permeable so that DNA can diffuse in. Electroporation—a short electric shock creates temporary pores in membranes, and DNA can enter. Viruses can be altered to carry recombinant DNA into cells.

Copy (& Read) DNA Transformation insert recombinant plasmid into bacteria grow recombinant bacteria in agar cultures bacteria make lots of copies of plasmid “cloning” the plasmid production of many copies of inserted gene production of “new” protein transformed phenotype DNA  RNA  protein  trait

*Grow bacteria…make more transformed bacteria gene from other organism + recombinant plasmid vector plasmid grow bacteria harvest (purify) protein

Uses of genetic engineering Genetically modified organisms (GMO) enabling plants to produce new proteins Protect crops from insects: BT corn corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) Extend growing season: fishberries strawberries with an anti-freezing gene from flounder Improve quality of food: golden rice rice producing vitamin A improves nutritional value For example, a transgenic rice plant has been developed that produces yellow grains containing beta-carotene. Humans use beta-carotene to make vitamin A. Currently, 70% of children under the age of 5 in Southeast Asia are deficient in vitamin A, leading to vision impairment and increased disease rates.

Transformed vertebrates Green with envy?? Jelly fish “GFP” Transformed vertebrates

I’m a very special pig! Got any Questions? 2007-2008