1. Genetic Engineering Biotechnology

2. We have been manipulating DNA for generations!
Artificial breeding
creating new breeds of animals & new crop plants to improve our food

3. Animal breeding

4. Breeding food plants “Descendants” of the wild mustard
the “Cabbage family”

5. Evolution of modern corn (right) from ancestral teosinte (left).
Breeding food plants
Evolution of modern corn (right) from ancestral teosinte (left).

6. A Brave New World

7. The code is universal Since all living organisms… use the same DNA
use the same code book
read their genes the same way
Strong evidence for a single origin in evolutionary theory.

8. human genome 3.2 billion bases
TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT
human genome 3.2 billion bases

9. Can we mix genes from one creature to another?
YES!

10. Transgenic Organisms
A type of genetically modified organism (GMO) that has genetic material from another species that provides a useful trait.

11. Benefits of Transgenic Organisms
Improved Productivity
Increased frost resistance
Improved Health
Golden Rice
Rice is low in iron and vitamin A.
Allergenic Free-Rice (No albumin)
Organisms that produce human proteins.

12. Mixing genes for medicine…
Allowing organisms to produce new proteins
bacteria producing human insulin
bacteria producing human growth hormone

13. Uses of genetic engineering
Genetically modified organisms (GMO)
enabling plants to produce new proteins
Protect crops from insects: BT corn
corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)
Extend growing season: fishberries
strawberries with an anti-freezing gene from flounder
Improve quality of food: golden rice
rice producing vitamin A improves nutritional value
For example, a transgenic rice plant has been developed that produces yellow grains containing beta-carotene.
Humans use beta-carotene to make vitamin A.
Currently, 70% of children under the age of 5 in Southeast Asia are deficient in vitamin A, leading to vision impairment and increased disease rates.

14. Applications of biotechnology

15. Ethical Issues Freedom of choice. Interference with nature
2/3 of processed foods include GMOs
Food sold in US is NOT labeled.
Interference with nature
Effects on the environment.
Technology is controlled by a few multinational corporations.