1. Biotechnology

2. A Brave New World

3. human genome 3.2 billion bases
TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT
human genome 3.2 billion bases

4. Biotechnology: Recombinant DNA
Insert a new gene
So it makes a new protein…
And has a new trait!
transcription
translation
DNA
RNA
protein
trait

5. Bacteria helpers Bacteria are opportunists Bacteria have plasmids
pick up foreign DNA wherever it may be hanging out
incorporate the DNA bits into their own chromosome
Bacteria have plasmids
Small circles of “naked” DNA in bacteria

6. How can plasmids help us?
A way to get genes into bacteria easily
insert new gene into plasmid
insert plasmid into bacteria
bacteria now expresses new gene
bacteria make new protein
transformed bacteria
gene from other organism
recombinant plasmid
plasmid
cut DNA +
glue DNA

7. How is this useful for us?
Insert human gene into a bacteria = get it to make a human protein!
cut DNA with enzymes
gene we want
like what?
…insulin
…HGH
…lactase
cut plasmid DNA with the same enzyme
Cut DNA?
DNA scissors?
ligase
insert “gene we want” into plasmid... “glue” together
recombinant plasmid

8. The code is universal Since all living organisms… use the same DNA
use the same code book
read their genes the same way
Strong evidence for a single origin in evolutionary theory.

9. Grow bacteria…make more
transformed bacteria
gene from other organism +
recombinant plasmid
vector
plasmid
grow bacteria
harvest (purify) protein

10. Uses of genetic engineering
Genetically modified organisms (GMO)
enabling plants to produce new proteins
Protect crops from insects: BT corn
corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)
Extend growing season: fishberries
strawberries with an anti-freezing gene from flounder
Improve quality of food: golden rice
rice producing vitamin A improves nutritional value
For example, a transgenic rice plant has been developed that produces yellow grains containing beta-carotene.
Humans use beta-carotene to make vitamin A.
Currently, 70% of children under the age of 5 in Southeast Asia are deficient in vitamin A, leading to vision impairment and increased disease rates.

11. Transformed vertebrates
Green with envy??
Jelly fish “GFP”
Transformed vertebrates

12. Cut, Paste, Copy… Word processing metaphor… cut paste copy
restriction enzymes
paste
ligase
copy
plasmids
bacterial transformation

13. I’m a very special pig! Got any Questions?