Emily Eder HC70AL - Spring 2005

Slides:



Advertisements
Similar presentations
Diagnosis with PCR This is a preparation of DNA. We zoomed in a portion of a gene. We know that two primers, Forward and Reverse, will hybridize at specific.
Advertisements

T-DNA Mutagenesis T-DNA Mutagenesis. Transfer-DNA Mutagenesis: a chemical or physical treatment that creates changes in DNA sequence which can lead to.
Mapping in Arabidopsis cont…
The Trihelix Transcription Factor Family Heather Hernandez.
20,000 GENES IN HUMAN GENOME; WHAT WOULD HAPPEN IF ALL THESE GENES WERE EXPRESSED IN EVERY CELL IN YOUR BODY? WHAT WOULD HAPPEN IF THEY WERE EXPRESSED.
HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana
Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.
What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.
At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.
What Are the Methods and Approaches Used Study Knock-Out Mutations? Elaine Chiu Nancy Phang June 4, 2009.
The MYB and BHLH Transcription Factor Families by Elaine Chiu.
Lab report structure I.Title II.Abstract III.Introduction IV.Methods and Materials V.Results VI.Discussion VII.References VIII.Figures.
Gene Regulation: What it is, and how to detect it By Jordan, Jennifer, and Brian.
BHLH - Basic Helix Loop Helix Family Protein Emily Eder HC 70AL - Spring 2005.
HC70AL Spring 2009 Gene Discovery Laboratory RNA and Tools For Studying Differential Gene Expression During Seed Development 4/20/09tratorp.
Using mutants to clone genes Objectives 1. What is positional cloning? 2.What is insertional tagging? 3.How can one confirm that the gene cloned is the.
F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.
HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.
Genomic sequencing in Plants R.Sakthivel
Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.
Cloning the OOMT2 Gene in Roses Kim Lovik Megan Hughes.
AP Biology DNA Study Guide. Chapter 16 Molecular Basis of Heredity The structure of DNA The major steps to replication The difference between replication,
The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.
Figure S1. Alignment of identified AtMYB93/92/53 homologues in land plants, used to infer the phylogeny in Figure 1B. Supporting information Figs S1-S7.
Chapter 11: Functional genomics
The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.
Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.
THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family
Daisy Robinton Matt Emmer Jason Chai
The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.
The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.
Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV.
Genetics & Genotyping By Kristin Gill & Daisy Robinton HC70AL Spring 2009.
Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.
Searching for Genes Important in Seed Development At1g19000 At1g74840 BY: Mike Douglas.
Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.
Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.
NAC Family Genes AT1G01720 AT1G77450
Supplemental Fig. S1 A B AtMYBS aa AtMYBS
Searching for the Genes that Control Seed Development
a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c
Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?
Biotech Tools Review
Is AT2G23290 Important in Seed Development?
Genetics Definitions Definition Key Word
Welcome to the world of two Arabidopsis genes:
Budding yeast has a small genome of approximately 6000 genes.
DNA Technology.
The Alfin-like PHD Zinc Finger Transcription Factor Family
محاضرة عامة التقنيات الحيوية (هندسة الجينات .. مبادئ وتطبيقات)
Does Gene AT5G19490 Play a vital role in seed development?
HC70AL Final Presentation
Put Your Dukes Up AT5G03220! Studying Embryo Lethality of
February 7, 2016 Journal: Why do you and your siblings have different traits even though you have the same parents?
HC70AL Oral Presentation
What is AT5G03500? --Background and Structure--
From Gene to Protein.
At2G37120: A Gene Exploration
Rotation review Gaurav Moghe Genetics Program
HC70AL Research Presentation
Heat Shock Factor Protein Family of Transcription Factors
Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2
Molecular cloning of pms916 salt hypersensitive T-DNA mutant.
Using mutants to clone genes
Arabidopsis Thaliana Gene AT5G58610
Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.
Posttranscriptional Gene Silencing Is Not Compromised in the Arabidopsis CARPEL FACTORY (DICER-LIKE1) Mutant, a Homolog of Dicer-1 from Drosophila  E.Jean.
Prokaryotic (Bacterial) Gene Regulation
Practical Contents DNA Extraction Gel Electrophoresis
7 WT 6 irx1-6 ixr fold increased expression 3 2 n- 1 AT1G18710
Presentation transcript:

Emily Eder HC70AL - Spring 2005 AT5g67300 Emily Eder HC70AL - Spring 2005

Arabidopsis Gene AT5g67300 Plant genotyping Sequencing and T-DNA insert RNA extraction and expression Using gel electrophoresis Using a genechip (microarray) Promoter Region

All Homozygous Mutants Genotypes All Homozygous Mutants

Genotypes cont.

AT5g67300 1216 Base Pairs in Length, Forward Orientation Codes for MYB Family Transcription Factor

Using Gel Electrophoresis to Determine RNA Expression

Using a Genechip (Microarray) to Determine RNA Expression

Promoter Region Why do we need to clone the promoter region of our gene? More accurate gene expression Why do we need to verify the sequence of the promoter region? Ensure that DNA sequence was not mutated

Promoter Sequence via Finch TV

Alignment Blast How can we verify that our sequence was not mutated? By blasting the two sequences together Verify mutations for both SP6 and T7

Using SP6 Primer No mutations

Using T7 Primer 1 mutation

Arabidopsis Gene AT6g67300 All Homozygous Mutant Plants One T-DNA insert with forward orientation RNA expression much higher in the leaf than the seed/silique Promoter region successfully cloned