Biology Sylvia S. Mader Michael Windelspecht Chapter 19 Taxonomy, Systematics, and Phylogeny Lecture Outline Copyright © The McGraw-Hill Companies, Inc.

Slides:



Advertisements
Similar presentations
Linnaeus developed the scientific naming system still used today.
Advertisements

LG 4 Outline Evolutionary Relationships and Classification
Organizing Life’s Diversity
Alberts, Bray, Hopkins, Johnson Copyright © 2004 Pearson Education, Inc., publishing as Benjamin Cummings Professor: Dr. Barjis Room: P313 Phone: (718)
Classification (Taxonomy)
Outline 19.1 Systematic Biology 19.2 The Three-Domain System 19.3 Phylogeny 1.
Sylvia S. Mader Copyright © The McGraw Hill Companies Inc. Permission required for reproduction or display PowerPoint® Lecture Slides are prepared by Dr.
CLASSIFICATION OF ORGANISMS. Biologists have classified nearly 2 million species Estimates range from 13 million to 40+ million The science of describing,
Classifying the Diversity of Life – Systematics: Study of the diversification of living forms, both past and present, and their relationships – Taxonomy:
Classifying Organisms
Chapter 22 SYSTEMATICS – BIODIVERSITY + EVOLUTION.
Chapter 18 – Classification
Ch 18- Classification Why do biologists organize living organisms into groups that have biological meaning? Study the diversity of life Use classification.
Phylogeny Systematics Cladistics
Classification of Organisms
Chapter 17 Table of Contents Section 1 Biodiversity
Tree of Life Chapter 26.
Classification This is Panorpa japonica. Commonly known as the scorpion fly.
Classification of Living Things. 2 Taxonomy: Distinguishing Species Distinguishing species on the basis of structure can be difficult  Members of the.
BIOLOGY Chapter 19 Phylogeny and Systematics. Copyright © 2003 Pearson Education, Inc. publishing as Benjamin Cummings Phylogeny is the evolutionary history.
Systematics Study of the diversity of organisms to classify them and determine their evolutionary relationships Taxonomy: naming, identifying and classifying.
Biology, 9th ed,Sylvia Mader
Chapter 18 Classification
Chapter 26 – Phylogeny & the Tree of Life
1 Systematics and the Phylogenetic Revolution Chapter 25.
Phylogeny & The Tree of Life. Phylogeny  The evolutionary history of a species or group of species.
Phylogeny and the Tree of Life
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 15 Lecture Slides.
The Living World Fourth Edition GEORGE B. JOHNSON Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display PowerPoint.
SYSTEMATICS AND PHYLOGENY.
March 3 rd, 2010  Warm Up Open to ch. 17 to follow along with lecture  Today Review Ch. 17 Lab  Homework Study for Ch. 17 exam on Friday.
Systematics the study of the diversity of organisms and their evolutionary relationships Taxonomy – the science of naming, describing, and classifying.
The Living World Fifth Edition George B. Johnson Jonathan B. Losos Chapter 18 Exploring Biological Diversity Copyright © The McGraw-Hill Companies, Inc.
The Evolutionary History of Biodiversity
Taxonomy Science of describing, naming, and classifying organisms. Designed by Linnaeus Based on morphology (form and structure) –Common name not useful.
© 2012 Pearson Education, Inc. Lecture by Edward J. Zalisko PowerPoint Lectures for Campbell Biology: Concepts & Connections, Seventh Edition Reece, Taylor,
Objective: Chapter 26- Biological Diversity. The Tree of Life Phylogeny is the evolutionary history of a species or group of related species What evidence.
Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu To View the presentation as a slideshow with effects select “View”
Using Phylogeny to Establish Evolutionary Relationships
The Tree of Life.
Johnson - The Living World: 3rd Ed. - All Rights Reserved - McGraw Hill Companies How We Name Living Things Chapter 12 Copyright © McGraw-Hill Companies.
Phylogeny & the Tree of Life
Early Systems of Classification  Biologists use a system of classification to organize information about the diversity of living things The History.
Biology Sylvia S. Mader Michael Windelspecht Chapter 19 Taxonomy, Systematics, and Phylogeny Lecture Outline Copyright © The McGraw-Hill Companies, Inc.
Biology Sylvia S. Mader Michael Windelspecht
Chapter 19 Systematics and Phylogency. Systematics reconstructs evoluntary history and classifies or groups organisms according to evolutionary findings.
Classification. Cell Types Cells come in all types of shapes and sizes. Cell Membrane – cells are surrounded by a thin flexible layer Also known as a.
Chapter 25 Phylogenetics.
Chapter 18 Classification. Classifying A great diversity of organisms requires a universal way to name them Taxonomy – allows biologists to name and classify.
Chapter 18: Classification
Chapter 17 BIOLOGY. HOW WOULD YOU CATEGORIZE THESE?
Classification Of Organisms Chapter 14 Coach Fults.
Classification Biology I. Lesson Objectives Compare Aristotle’s and Linnaeus’s methods of classifying organisms. Explain how to write a scientific name.
Chapter 17 Taxonomy. Chapter 17 Organizing Life’s Diversity Section 1: The History of Classification Section 2: Modern Classification Section 3: Domains.
17.1 The Linnaean System of Classification KEY CONCEPT Organisms can be classified based on physical similarities.
Biology Sylvia S. Mader Michael Windelspecht
Classification of Living Things Chapter 20. Classification of Living Things 2OutlineTaxonomy  Binomial System  Species Identification  Classification.
Depending on where you live, this might be a mountain lion, cougar, puma, or panther – all of these are “common” names for the “Felis concolor”
Phylogeny & Systematics The study of the diversity and relationships among organisms.
Ancient Classification:
Biology, 9th ed,Sylvia Mader
Biology, 9th ed,Sylvia Mader
How to Use This Presentation
Classification of Living Things
Phylogeny & the Tree of Life
Biology Sylvia S. Mader Michael Windelspecht
Chapter 17: Organizing Life’s Diversity
Biological Classification Honors Biology.
Chapter 19 Classification and Systematics
Classifying Organisms
Presentation transcript:

Biology Sylvia S. Mader Michael Windelspecht Chapter 19 Taxonomy, Systematics, and Phylogeny Lecture Outline Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. See separate FlexArt PowerPoint slides for all figures and tables pre-inserted into PowerPoint without notes. 1

19.1 Systematic Biology Taxonomy is the branch of biology concerned with identifying, naming, and classifying organisms.  A natural system of classification reflects the evolutionary history of organisms.  Naming and identifying organisms began with the Greeks and Romans. Aristotle classified organisms into groups such as horses, birds, and oaks  In the Middle Ages, organisms were described using Latin names. 2

Systematic Biology In the mid-eighteenth century, Carolus Linnaeus developed the system of binomial nomenclature  First word is the genus name  Second word is the specific epithet Refers to one species (of potentially many) within its genus  A species is referred to by the full binomial name (Genus species)  Genus name can be used alone to refer to a group of related species 3

Carolus Linnaeus 4 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. a: Courtesy Uppsala University Library, Sweden; b: © Arthur Gurmankin/Visuals Unlimited; c: © Dick Poe/Visuals Unlimited a. b. Lilium canadensec. Lilium bulbiferum

Systematic Biology Modern taxonomists use the following classification:  Species  Genus – one or more species  Family – one or more genera  Order – one or more families  Class – one or more orders  Phylum – one or more classes  Kingdom – one or more phyla  Domain – one or more kingdoms 5

The Classification System 6 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DOMAIN Eukarya Kingdom Animalia PHYLUM Chordata CLASS Amphibia CLASS Mammalia GENUS Mus GENUS Rana ORDER FAMILY ORDER Anura ORDER Rodentia FAMILY Muridae SPECIES Rana catesbeiana North America bullfrog Mus musculus house mouse FAMILY Ranidae

Systematic Biology The higher the category, the more inclusive Organisms in the same domain have general characteristics in common Members of a species share very specific characteristics. The task of creating standardized rules of nomenclature is difficult and has, most recently, been aided by the process of DNA barcoding  Compares short fragments of DNA sequences from an unknown organism to a large database of sequences from known organisms. 7

DNA Bar Coding of Life Traditionally, taxonomists relied on anatomical data Consortium for the Barcode of Life (CBOL), proposes that all scientists will be able to identify a species with the flick of a handheld scanner.  Like the 11-digit Universal Product Code (UPC) used in a supermarket, DNA is the UPC of organisms on Earth A DNA–bar-coding device would provide a fast and inexpensive way to catalog organisms. 8

19.2 Three-Domain System Sequencing of rRNA suggests that all organisms evolved along three distinct lineages:  Domain Bacteria Prokaryotic unicellular organisms that reproduce asexually. Cyanobacteria are large photosynthetic prokaryotes. Most bacteria are heterotrophic. Important in ecosystems - keeping chemical cycling going. Some bacteria are parasitic and cause disease.  Domain Archaea Prokaryotic unicellular organisms that reproduce asexually. Live in extreme environments. Cell wall is diverse but not the same as the bacterial cell wall. 9

Three-Domain System  Domain Eukarya Unicellular and multicellular organisms Cells with a membrane-bounded nucleus Sexual reproduction is common Contains four kingdoms –Kingdom Protista –Kingdom Fungi –Kingdom Plantae –Kingdom Animalia 10

Tree of Life Showing the Three Domains 11 common ancestor ARCHAEA BACTERIA EUKARYA animals fungi plants cyanobacteria protists heterotrophic bacteria Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

19.3 Phylogeny Systematics is the study of diversity of organisms using information from cellular to population levels One goal of systematics is to determine phylogeny (evolutionary history) of a group Phylogeny is often represented as a phylogenetic tree  A diagram indicating lines of descent  Each branching point: Is a divergence from a common ancestor Represents an organism that gives rise to two or more new groups 12

Phylogeny Classification lists the unique characters of each taxon and is intended to reflect phylogeny  Ancestral traits: Present in all members of a group, and Present in the common ancestor  Derived traits: Present in some members of a group, but absent in the common ancestor 13

The Relationship Between Phylogeny, Classification, and Traits 14 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display Trait Evolution DerivedAncestral ClassificationPhylogeny Common ancestors artiodactyl common ancestor even-toed hooves mammal common ancestor mammary glands primate common ancestor opposable thumb Family Hominidae: apes Class Mammalia Order Artiodactyla Family Cervidae: deer Family Cebidae: monkeys Order Primates Family Bovidae: cattle apes shoulder rotation deer antlers monkeys tail cattle horns

Phylogeny Cladistics is a way to analyze primitive and derived characters and by the construction of phylogenetic trees called a cladogram on the basis of shared derived characters.  Arrange taxa into a cladogram A cladogram is a special type of phylogenetic tree  A clade is an evolutionary branch that includes: A common ancestor, together with All its descendent species  It traces the evolutionary history of the group being studied. 15

Phylogeny Cladists are guided by the principle of parsimony—the minimum number of assumptions is most logical.  The best cladogram is one in which the fewest number of shared derived characters are left unexplained or that minimizes the number of assumed evolutionary changes. Reliability of cladograms is dependent on the knowledge and skill of an investigator. 16

Constructing a Cladogram: The Data 17 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. chimpanzee dogfinch crocodilelizard frog tuna lancelet (outgroup) Species Traits mammary glands gizzard epidermal scales amniotic egg four limbs vertebrae hair ingroup notochord in embryo

Constructing a Cladogram: The Phylogenetic Tree 18 vertebrae four limbs feathers gizzard hair, mammary glands long canine teeth enlarged brain chimpanzee tuna frog lizard crocodile finch terrier lancelet (outgroup) common ancestor epidermal scales Amniotic egg common ancestor Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Phylogeny Tracing Phylogeny  Fossil Traits Fossil record is incomplete It is often difficult to determine the phylogeny of a fossil  Homology Refers to features that stem from a common ancestor Homologous structures are related to each other through common descent  Analogy Similarity due to convergent evolution Analogous structures have the same function in different groups but do not have a common ancestry Structures look similar due to adaptation to similar environments 19

Phylogeny Tracing Phylogeny  Behavioral Traits Parental care, mating calls, etc.  Molecular Traits Systematics assumes: –Two species with similar base-pair sequences are assumed to be closely related –Two species with differing base-pair sequences are assumed to be only distantly related 20

DNA Sequence Alignment Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. ccccgtggaggtacgcttcactc ccccgtggaggtgcgcttcactc tccggtggaggtgcgcttcgccc ccccgtggaggtgcgcttcaccc ccccgtagaggtgcgcttcaccc ccctgtggaggtccgcttcaccc ccctgtgggggtgcgcttcaccc cctggtggggctacgcttcacct cctggtgggggtacgcttcacct cccggtgggggtgcgcttcaccc accggtgggggtgcgcttcaccc Cow Pig Horse Mouse Rat Macca Orangutan Human Chimp Guinea Pig Dog

Phylogeny Tracing Phylogeny  Protein Comparisons Immunological techniques –Degree of cross reaction used to judge relationship Amino acid sequencing –Similar sequence in the same protein indicates a close relationship  Molecular Clock Use neutral (non-adaptive) nucleotide sequences Assumes a constant rate of mutation over time 22

A Phylogeny Determined from Molecular Data 23 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. human PRESENT white-handed gibbon rhesus monkey green monkey capuchin monkey Million years ago (MYA) Increased difference in DNA common chimpanzee